1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
2 years ago
14

Can someone help me put it in the right place?

Biology
2 answers:
katrin2010 [14]2 years ago
8 0

Answer:

sister chromatids on top

chromosomes on bottom

Explanation:

The ones on top are sister chromatids because they are conjoined by the centromere.

On bottom a strand of condensed chromatin fiber is represented which is called chromosome

Alex787 [66]2 years ago
5 0

Answer:

Sister chromatids on the top and Chromosomes on bottom

You might be interested in
A researcher is creating pedigrees for a trait he suspects to be dominant in humans. what are some of the likely features of his
xz_007 [3.2K]
A feature of a pedigree that indicate that a certain trait is a dominant trait is that one of the parents always have to have the trait.

There are, however, autosomal dominance and X-linked dominance.

For an autosomal dominant trait: 
- Appears equally frequent in both sexes.
- Both sexes transmit the trait.
- Present in all generations.
- When one parent has the trait and the other doesn't, approximately half of the offspring will present the trait.

For a X-linked dominant trait: 
- Both male and females can present the trait, but more females usually present it.
- Sons with the trait always have a mother that presents the trait as well.
- Daughters with the trait always have either a mother or father that presents the trait, or both.
- Fathers with the trait always have daughters with the same trait.
7 0
3 years ago
Read 2 more answers
State four reasons for presence of supporting tissues in plant​
BaLLatris [955]

Answer:

Parenchyma, Collenchyma, Sclerenchyma, Vascular tissues

Explanation:

7 0
3 years ago
The Weaver birds from the African savanna exhibit a trade-off between risking starvation and being hunted by predators. As a res
oksano4ka [1.4K]
Vigilance is the natural selection at work.
5 0
3 years ago
Read 2 more answers
Ribosomes are made in the nucleolus. What happens once the ribosome passes into the cytoplasm?
victus00 [196]

The Answer is B, as they attach to the endoplasmic reticulum so that the protein process can occur

3 0
3 years ago
Read 2 more answers
What kind of animals are best suited to life in a desert?
Kitty [74]

Camel, rats and snakes

5 0
3 years ago
Read 2 more answers
Other questions:
  • The following is a list of the events that occur during a muscle contraction. What is the correct sequence of these events? 1. M
    9·1 answer
  • The classifications system changed from seven to get. This happened because
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Describe compliance with public health statutes:
    12·1 answer
  • What is the main difference between purines and pyrimidines?
    15·1 answer
  • Which statement describes two organ systems working together to deliver nutrients to cells?
    9·2 answers
  • Is a carbon atom most likely to form covalent or ionic bonds
    7·2 answers
  • Ano itong paniniwala o pag-iisip na anumang inaasam ng isang tao ay karapatan na dapat bigyan ng dagliang pansin?
    9·1 answer
  • Normal red blood cells slide easily through narrow blood vessels. In sickle cell disease, many red blood cells change to a cresc
    7·1 answer
  • Some kinds of algae produce toxins.<br> A. True<br> B. False
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!