Mutations of the DNA are only passed on to future generations if the change occurred in a –

Biology

2 answers:

denis-greek [22]2 years ago

8 0

Answer:

A. sperm or egg cell............

Phantasy [73]2 years ago

3 0

Mark them brainliest L.m.f.a.o do u seriously not know tho

You might be interested in

WINNER AS BRAINLIEST HELP ME ANSWER THESE ASAP

Mnenie [13.5K]

Answer: pretty sure the answer is C

Explanation:

7 0

3 years ago

Read 2 more answers

A certain species of grasshopper can have red stripes, yellow stripes, or red and yellow stripes. An RR grasshopper has red stri

DaniilM [7]

Answer:

you would have 100% RY grasshoppers. All their offspring would have red and yellow stripes

Explanation:

Using a punnet square

Y Y

R RY RY

it would look like this

( sorry for the horrible punnet square)

8 0

3 years ago

Read 2 more answers

What will be the contents for the presentation named DNA molecule natural selection.

VLD [36.1K]

Which patterns of life were established during the time of the Umm an-Nar culture that still exit today pleas help me I ran out of poinst:(

4 0

3 years ago

Using land for agriculture and forestry can lead to soil erosion. Which of the

VLD [36.1K]

All of them are correct soil erosion turns grains of soil into mere grains of sand which when placed in water makes the water much cloudier, biodiversity will decrease as soil erosion leads to a more Barron and dry landscape, respiratory disease may be caused by inhaled particles of dust which can be create from soil erosion, and desertification as mentioned earlier soil erosion leads to a more baron and dried out landscape as the soil can’t hold water as much as it used too.

7 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago