1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ladessa [460]
3 years ago
14

Cells are restricted to being small in size. Why are cells limited in size

Biology
1 answer:
Gnoma [55]3 years ago
3 0
C.both of these are true
You might be interested in
Which of the following examples can cause gene flow between populations?
Ipatiy [6.2K]

Answer: c. Bird droppings that contain seeds from a different location

7 0
2 years ago
Read 2 more answers
In which situation would artificial insemination most likely be used over other forms of treatment?
lana [24]
OB. A man’s testicles have not properly descended, lowering sperm count
7 0
3 years ago
What happens in meiosis during anaphase I?
Mandarinka [93]

Anaphase I begins when the two chromosomes of each bivalent (tetrad) separate and start moving toward opposite poles of the cell as a result of the action of the spindle. Notice that in anaphase I the sister chromatids remain attached at their centromeres and move together toward the poles.

5 0
4 years ago
Read 2 more answers
Why? from the smallest single celled organism to the tallest tree, all life model 1?
arsen [322]
From the smallest single celled organism to the tallest tree all life depend on the properties and reactions of four marcro molecules which are carbohydrate, protein, lipids and nucleic acid.
This is because, these organic molecules are the building blocks of all living things and they are responsible for most of the structure and functions in the body.
8 0
3 years ago
According to theories of weight gain, Calorie consumption has increased dramatically due to all of the following except
WARRIOR [948]

Answer: Protein consumption

Explanation:

Consuming proteins produces greater satiety, improves blood glucose stability and improves lipid levels, and balancing carbohydrate consumption with protein consumption is studied as a dietary alternative.

8 0
4 years ago
Other questions:
  • A unicellular organism that lives in complete darkness deep on the ocean floor near a volcanic vent is which of the following? a
    6·1 answer
  • Which side of a leaf transpires the most?
    10·1 answer
  • Where does the fertilized egg grow and develop while a woman is pregnant
    9·1 answer
  • Innate immunity________.
    7·1 answer
  • Which of the following is found in both prokaryotic and eukaryotic cells?
    11·1 answer
  • What are two parts of the peripheral nervous system
    13·1 answer
  • Which statement about asexual reproduction is true?
    12·2 answers
  • sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
    7·1 answer
  • Why do so many more people have brown eyes then blue eyes
    11·1 answer
  • DNA is found in _______ of the nucleus of cells.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!