1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
3 years ago
6

Which organelle is responsible for the construction of sugars during the process of photosynthesis?

Biology
1 answer:
SVEN [57.7K]3 years ago
3 0

Answer:

chloroplast !

Explanation:

You might be interested in
Bronchitis is a disease of which of the following organs?
liubo4ka [24]
The answer is D.) respitory tract

4 0
3 years ago
On chromosome 1 of fruit flies, the gene for yellow body is 27.5 map units away from the gene for tan body, 43 map units away fr
Masja [62]

Answer:

the gene for yellow body and the gene for forked bristles

Explanation:

The two genes that will have the highest recombination frequency are the gene for yellow body and the gene for forked bristles.

<em>Gene recombination refers to the exchange of genetic materials between different gene-containing regions (loci) on the same chromosome or between two or more independent chromosomes. A linkage map shows the frequency of recombination between genes.</em>

Generally, on a linkage map, when two loci are close to one another on the same chromosome, the frequency of recombination of the genes would be less than that of two loci that are further apart. In other words, the closer the loci, the lower the frequency of gene recombination and vice versa.

<em>In this case, the distance between the genes for yellow body and tan body is 27.5 map units, yellow body and sable body is 43 map units, yellow body and forked bristles is 56.7 map units. </em><u><em>The genes for yellow and forked bristles are the furthest to each other with 66.7 map units and, as such, will have the highest recombination frequency. </em></u>

8 0
3 years ago
What do u mean by sporangium​
Olegator [25]

Answer:

A sporangium (plural: sporangia) is the capsule structure belonging to many plants and fungi, in which the reproductive spores are produced and stored. ... The majority of sporangia produce haploid spores through meiosis, although some are able to produce spores through mitosis.

Found this on google, hope it helps, have a great day/night and stay safe!

5 0
3 years ago
Read 2 more answers
Can you pls use relative humidity in a sentence
Minchanka [31]
The weather man said the relative humidity will be high today
7 0
4 years ago
Read 2 more answers
As precipitation infiltrates into the subsurface soil, it generally forms an unsaturated zone and a saturated zone. In the unsat
Yakvenalex [24]

Answer:

d

Explanation:

4 0
3 years ago
Other questions:
  • This table gives the masses of several planets.
    15·2 answers
  • Which of the following is an example of a falsifiable hypothesis that could lead to scientific knowledge?
    8·1 answer
  • How does recycling help oceans?
    13·1 answer
  • Which of the following is true about reproduction. That involves meiosis?
    10·2 answers
  • Alina started her stamp collection with 15 stamps. every month after that, she added 3 more stamps to her collection how many st
    12·1 answer
  • Scarlet’s friend in biology class rarely pays attention when the teacher speaks. Almost every day, this friend asks Scarlet to m
    9·2 answers
  • Staphylococcus aureus is grown in heart-infusion broth at 37°C. If you start exponential phase with 100 cells, and after 90 minu
    15·1 answer
  • I put in the answer and it said it was wrong so are you sure it right?
    12·1 answer
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • The many changes in the fossils of mammals that are recovered are BEST explained as a result of
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!