1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxTIMURxx [149]
3 years ago
13

How do you think Darwin came up with his theory?

Biology
1 answer:
Wittaler [7]3 years ago
5 0

Answer:

The theory of evolution by natural selection, first formulated in Darwin's book "On the Origin of Species" in 1859, is the process by which organisms change over time as a result of changes in heritable physical or behavioral traits. Changes that allow an organism to better adapt to its environment will help it survive and have more offspring.

Evolution by natural selection is one of the best substantiated theories in the history of science, supported by evidence from a wide variety of scientific disciplines, including paleontology, geology, genetics and developmental biology.

The theory has two main points, said Brian Richmond, curator of human origins at the American Museum of Natural History in New York City. "All life on Earth is connected and related to each other," and this diversity of life is a product of "modifications of populations by natural selection, where some traits were favored in and environment over others," he said.

More simply put, the theory can be described as "descent with modification," said Briana Pobiner, an anthropologist and educator at the Smithsonian Institution National Museum of Natural History in Washington, D.C., who specializes in the study of human origins.

The theory is sometimes described as "survival of the fittest," but that can be misleading, Pobiner said. Here, "fitness" refers not to an organism's strength or athletic ability, but rather the ability to survive and reproduce.

You might be interested in
OKKKKKK MORE
Tems11 [23]

Answer:

Microscopic observations have shown that the cell is the smallest functional unit of life. We now know the various organelle (or organs) of an individual cell and how they work. For example, a bacteria is a single-cell organism and is capable of carrying out all its life process (growth, division, metabolism, etc.)

Explanation:

<h3><em>The contents of the cell, or the structures of the cell, allow the cell to be "specialized." Together with the cell's proteins, they allow the cell to do specific things. They allow a cell to act like a neuron or a bone cell or a skin cell.</em></h3>
7 0
2 years ago
Read 2 more answers
Which of the following can be used to cut DNA so it can be studied?
irga5000 [103]
Answer is A. restriction enzyme 
In biology ,Restriction enzyme is known as a scissor.
5 0
3 years ago
Read 2 more answers
How does the term “selectively permeable” apply to a membrane?
Vladimir79 [104]

Answer:

Explanation:Selectively permeable means a membrane allows the passage of some molecules or ions and inhibits the passage of others. The capacity to filter molecular transport in this manner is called selective permeability

6 0
2 years ago
Read 2 more answers
What is a parasitic relationship?
iris [78.8K]
The answer is A.......
4 0
2 years ago
Read 2 more answers
Respiration occurs in the__________
BaLLatris [955]

Answer:

cells of the body

Explanation:

Respiration happens in the cells of plants, animals and humans, mainly inside mitochondria, which are located in a cell’s cytoplasm, energy released during respiration is used by plants to make amino acids, and by animals and humans to contract their muscles to let them move. Don't confuse respiration with breathing. Respiration releases energy, while breathing

7 0
2 years ago
Other questions:
  • which of the following provides the best analogy for an electron in an atomic orbital? a. a bee moving from flower to flower in
    11·1 answer
  • A scientist has a pea plant with yellow seeds. It has one allele for yellow seeds (Y) and one for green seeds (y).
    7·2 answers
  • Which was not produced by volcanic outgassing?
    12·2 answers
  • Give two examples of friction being a useful force
    12·2 answers
  • Why does there tend to be more life in the upper portions of aquatic<br> ecosystems?
    12·1 answer
  • Which show that the results of an experiment are reliable
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Do all living things need mates, to produce newborns?
    13·1 answer
  • Two true-breeding stocks of pea plants are crossed. one parent has red, axial flowers and the other has white, terminal flowers;
    9·1 answer
  • The genetic material inherited in an organelle, such as a mitochondrion or a chloroplast, exhibits _____ inheritance.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!