1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nasty-shy [4]
3 years ago
7

What is the correct order of organization for populations from least to most complex

Biology
1 answer:
ahrayia [7]3 years ago
8 0
Populations 
communities
ecosystem
biosphere

You might be interested in
The adult spinal cord ends between the level l1 and l2 of the vertebral column. True or False
viktelen [127]

this is true...........

6 0
3 years ago
Which pair of terms could be used to describe the location of the nose when compared to the location of the eyes
stiv31 [10]

The pair of terms used to describe the location of the nose

when compared to the location of the eyes are medial and

inferior.

<h3>What is Location?</h3>

Location refers to the exact position of a particular object or

organism. In humans, location of different parts of the body

varies.

The location of the nose is medial to the eyes which means it is

found in the mid-line region of the eyes. The nose is also

inferior to the eyes as it is found in the lower region of where

the eye is located.

Read more about Location here brainly.com/question/1401793

6 0
2 years ago
R-related species have a short life span and an early reproduction cycle? t or f
GREYUIT [131]

It is true that r-related species have a short life span and an early reproduction cycle. R-related species also known as  r-strategist have a short and simple life span. Due to their simple life span, their nutrient exchange rate with the environment is rapid. Unlike K-selected species, they have the ability to reproduce at a young age. They reproduce a large number of off-springs, but many of their off-springs tend to die before attainment of their reproductive age.

5 0
4 years ago
How do enzymes affect chemical reactions and activation energy?
lara [203]
Enzymes (Catalysts) lower the required activation energy, allowing the reaction to happen more quickly. 
3 0
3 years ago
In which order will free nucleotides add on to a single strand of DNA with the sequence ATTGCA during DNA replication? (2 points
Iteru [2.4K]

Answer:

guanine, cytosine, cytosine,adenine,thymine,guanine

Explanation:

This is because during DNA replication the complementary base pairings are Adenine and Guanine, Thymine and Cytosine.

4 0
3 years ago
Other questions:
  • What are long chains of carbon molecules called?
    13·1 answer
  • How are stem cells important in planaria?
    13·1 answer
  • Enzymes can . . . (check all that apply)
    9·1 answer
  • As global warming continues, the oceans absorb more of the Earth’s heat. What term describes the ocean as a storage location for
    7·1 answer
  • Why are small quantities of chlorofluorocarbons so harmful to the ozone layer?
    6·1 answer
  • What is the basic function of catabolic operons like the lac operon?
    10·1 answer
  • Do you think ancient Antarctica was situated in a different location from its location today? Why or why not?
    13·2 answers
  • List three (3) types of morphological characteristics of microorganisms which may be determined without using a microscope.
    11·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Mitosis and meiosis are cell division mechanisms that lead to different numbers of daughter cells. Which explanation best descri
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!