the answer you are looking for is B. Glucose is broken down into two pyruvate molecules.
this process occurs during glycolysis
Answer choice A. Stasis.
Stasis is a block of little to no change in a species.
The ratio of Carbon, Hydrogen, and Oxygen are 1:2:1 in carbohydrates
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer: (1) Providing an optimized orientation of the substrate.
(2) Decreasing the ∆G in reaction.
(3) Excluding excess water.
Explanation: The active sites of enzymes increase the rate of reaction because they decrease the activation energy of the reaction,and the physical microenvironment provides an optimal orientation of the substrate relative to reactive functional groups while excluding excess solvent,such as water.
Although some active sites may have amino acids that form salt bridges with the amino acids from a substrate,not all do, so this is not a generic strategy of active site microenvironments
*Gotten directly from Quizlet*
