Some renewable energy sources are Wind, Solar, and water, these are all better to use then like coal or gas to power houses or cars, there safer to use because they dont produce any harmful chemicals like coal or gas do.
The answer is b thank and rate my answer for 30 points they come in in 35 minutes
C.
A is incorrect because if they have the disease then they cannot be healthy.
B is incorrect because if the genetic disease is recessive then the cannot have the homozygous mutated gene because then it would mean that they are ill.
D is incorrect because having an offspring that is ill doesn't always guarantee that all the offspring will be ill. <span />
A mass movement is movements of masses of bodies of soil, bed rock, rock, debris, soil etc. which usually occur along steep-sided hills and mountains because of the pull of gravity
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
