1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saw5 [17]
3 years ago
7

Cell culture inserts/microporous membranes promote the proper phenotype of a variety of endothelial cells including kidney cells

, intestinal epithelial cells and others. Equally as important is the fact that these devices can be used to study transcytosis, a process discussed briefly in the cell culture lecture.
What is transcytosis and why does the device described above allow one to study this process compared to a typical, plastic cell culture plate?
Biology
1 answer:
JulsSmile [24]3 years ago
4 0

Answer:

Explanation:

Transcytosis is the transfer of molecules across cells from one side to the other, a process that entails endocytosis, vesicular transfer and exocytosis, and which speeds the bulk movement of molecules through tissues.

You might be interested in
6. Which type of ice is responsible for sea level rise? *
Sliva [168]

Answer:

Sea Ice

Explanation:

7 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What are some ways water is used inside and around the home? Check all that apply. boiling pasta for dinner watering the front l
sleet_krkn [62]

The answers that apply are;

  • boiling pasta for dinner
  • watering the front lawn
  • brushing teeth before bed

Around the homestead, water is not used in an industrial scale.

3 0
3 years ago
Read 2 more answers
What are three freshwater environments
Tems11 [23]

What are three freshwater environments?

1(Rivers

2(Lakes

3(Streams

4 0
3 years ago
Read 2 more answers
An organism with the genotype of aaxx can produce gametes containing _________ if the two genes are unlinked.
mars1129 [50]
<span>either AX, Ax, aX, ax
Hope this helps!!</span>
5 0
3 years ago
Other questions:
  • A student in your class suggests that when most people watch exciting sporting events on television,their pulse rates increase.w
    15·1 answer
  • What is the entire object shown in the image?
    14·2 answers
  • Help solve this please I don't know how to do this
    8·2 answers
  • Which of the following is not play a role in determining whether individuals get cancer from a carcinogen?
    15·1 answer
  • Some people informally call the light-dependent reactions the “light reactions” and the light-independent reactions the “dark re
    8·1 answer
  • Two plants are crossed, resulting in offspring with a 3 dominant:1 recessive phenotypic ratio for a particular trait. This ratio
    9·1 answer
  • A mouse are 380 calories worth of cherries. A fox catches it . How many calories does the fox obtain?
    6·1 answer
  • Hızlanma hareketine 3 er örnek​
    10·1 answer
  • What is the one characteristic, besides function and nucleotide sequence, that makes all the different types of RNA different fr
    5·1 answer
  • The age of rock as determined by the other rock surrounding it is known as ______________.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!