1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenKa [72]
3 years ago
7

Where did the Aryan peoples move from when they migrated to the Indian Subcontinent?​

Geography
1 answer:
levacccp [35]3 years ago
4 0

Answer:

Aryans moved from the area of todays Afghanistan to the Indian subcontinent during the period of Indo-Aryan migration, somewhere around 1800 and 1500 BC.

Explanation:

Some scholars don't agree with this theory that the Aryans migrated to the Indian subcontinent, but most of historians are arguing that during this migration they came from the North and destroyed the Dravidians who were living there. Their period that started during the migration is known as Vedic period.

You might be interested in
What map shows Elevation?
gogolik [260]
A topographical map shows elevation
4 0
3 years ago
identify the terms or phrases that are paired together correctly A.desert and dwarf trees B.temperate and deciduous forest and e
Snezhnost [94]
Hm, i'd got with d. tundra and permafrost 
5 0
3 years ago
Read 2 more answers
Which ten provinces, territories, and states do the Rocky Mountains run through?
igomit [66]
I dont understand plz say it more clearly
4 0
3 years ago
Can someone please help me with this
Zielflug [23.3K]
I'm sorry i do not know the answer, but in the picture you took i noticed how it said hint try clicking on that and I also noticed it said chapter 2 at the top of the page if that is a reading source that has information i would read through that or put a link to that so we can read it and see if it helps us get the most accurate answer.
8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • What bird species is found almost exclusively in the southern hemisphere
    13·1 answer
  • The temperature at which the air can hold no more water is
    13·2 answers
  • A pion is an unstable particle that has a mean lifetime of 2.55 × 10-8 s. This is the time interval between its creation in a nu
    6·1 answer
  • Which layer of a tropical rainforest receives the least sunlight?
    6·2 answers
  • What is the biggest continent?
    11·2 answers
  • Can water change the land quickly, slowly, or both? Explain
    5·1 answer
  • 1. Which region of the country is least likely to have a drought in the near-term?​
    13·1 answer
  • Which two processes commonly generate magma?
    10·1 answer
  • We get _______ life giving gas from trees.<br> whats the answer?
    13·1 answer
  • Which place is closer to Mount Everest: Taj Mahal or Great Wall of China?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!