1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
icang [17]
2 years ago
10

PLEASE HELP Which word describes the speed at which the "global conveyor belt" moves?

Biology
1 answer:
mario62 [17]2 years ago
6 0

Answer:

The conveyor belt moves at much slower speeds (a few centimeters per second) than wind-driven or tidal currents (tens to hundreds of centimeters per second). It is estimated that any given cubic meter of water takes about 1,000 years to complete the journey along the global conveyor belt

You might be interested in
Your classmate will be doing a presentation on evolutionary medicine in science class. What is he likely to discuss?
damaskus [11]
Evolutionary Medicine often called Darwinian Medicine is the application of evolutionary studies to medicine. The goal is to use evolutionary theory to better understand health and disease. The goal is to understand better why people get sick and not just how they get sick. 
6 0
2 years ago
You have chosen to study the genetics of snapdragon flower color. True-breeding red-flowered plants crossed with true-breeding w
olya-2409 [2.1K]

Answer:

Incomplete dominance.

Explanation:

Mendel is known as the father of genetics. He had explained the different inheritance pattern present in different organisms. The Mendel explained the law of segregation, law of independent assortment and concept of dominance.

The incomplete dominance may be defined as the inheritance pattern in which the dominant trait is unable to express it self completely in the heterozygous condition and blending traits are produced. Here, the red color is unable to express itself in the heterozygous condition and produce pink color.

Thus, the correct answer is option (E).

6 0
3 years ago
A frog with a mass of 0.29kg hops up in the air. At the highest point in the hop, the frog has a gravitational potential energy
PtichkaEL [24]

Answer:

0.27m

Explanation:

To get the energy

Potential energy= Mgh

M is Mass

G is acceleration due to gravity

H is height..

M= 0.29kg, h= ?

P=0.759. g=9.8m/s

Therefore,

0.759=0.29×9.8×h

H= 0.759÷2.842

H= 0.27m

8 0
3 years ago
The tube in the penis where sperm exits is
Alex777 [14]

Answer:

The <u>vas deferens</u> transports mature sperm to the urethra in preparation for ejaculation.

7 0
3 years ago
How were you able to determine if something was living, once living, or never living (non-living)?
snow_lady [41]

Answer:

Must have lived before.

Explanation:

For an organism to be classified as once living, an object must have been part of a living organism or is now dead. When a flower is plucked from a plant it is hard to distinguish between when it is considered alive and when it is now considered once living. An example of a nonliving object is an apple or a dead leaf.Apr 22, 2013

Utah Education Network › view

4 0
3 years ago
Other questions:
  • What feature of the inner membrane of the mitochondrion allows this organelle to produce a great amount of energy?
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is a base?
    15·1 answer
  • The distinctive yellow of sulfur
    6·2 answers
  • What does lipase digest?<br>A. Carbohydrates<br>B. Proteins<br>C. Fats
    14·1 answer
  • Which of the following is true about science?
    9·2 answers
  • The rough endoplasmic reticulum is a cell structure that consists of folded membranes that contain ribosomes . What is the advan
    5·1 answer
  • Which scientist devised tests that helped confirm that bacteria and other microorganisms cause a variety of diseases?
    12·1 answer
  • 18
    11·1 answer
  • What are the PRODUCTS in photosynthesis?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!