1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arturiano [62]
3 years ago
10

In an experiment, a scientist isolates mitochondria from living cells and suspends them in two different buffered solutions. One

solution is maintained at pH 4, while the other solution is maintained at pH 9. The
scientist finds that mitochondria in the solution at pH 4 continue to produce ATP but those in the pH 9 solution do not
The results of the experiment can be used as evidence in support of which of the following scientific claims about mitochondrial activity?
Mitochondria in a cell free environment are unable to convert thermal energy into ATP.
The electron transport chain pumps electrons from the cytosol to the mitochondrial matrix,
CATP production in mitochondria requires a hydrogen ſon gradient that favors movement of protons into the mitochondrial matrix.
D
ATP synthase molecules change their orientation in relation to the proton gradient across the mitochondrial membrane.
Biology
2 answers:
Law Incorporation [45]3 years ago
7 0

Answer:C

Explanation:

densk [106]3 years ago
4 0

Answer: C

Explanation:

You might be interested in
Photorespiration is detrimental for a plant because
Molodets [167]
Photorespiration is detrimental for a plant because no glucose is produced.
8 0
3 years ago
Radiant heat cannot travel through a vacuum.<br> true or false
rjkz [21]
The answer is False. I hope this helps!

5 0
4 years ago
Read 2 more answers
Which type of evidence is least likely to result in changes to a phylogenetic tree?
Whitepunk [10]
<span>Best source of data for defining phylogenetic relationships of in line of protists that occurs hundreds of millions of years ago is called DNA sequences for ribosomal RNA. Choose the tree that symbolize the fewest evolutionary changes, either in DNA sequence comparisons or morphological characters. </span>
3 0
4 years ago
Read 2 more answers
The impact craters on the moon were created by collisions with
masha68 [24]
The impact craters on the moon are created by collisions made by other asteroids many thousands of years ago

6 0
4 years ago
A student infected by a common cold virus ran a low-grade fever. After a few days, the student’s temperature returned to normal
Mandarinka [93]
The best and most correct answer among the choices provided by the question is the second choice. Our immune system has certain defense mechanics that protects us from pathogens, such examples are the white blood cells. <span>I hope my answer has come to your help. God bless and have a nice day ahead!</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Due to malnutrition, a child's stomach, limbs, and face may swell with water so that the child actually appears chubby, but in f
    14·1 answer
  • Bacteria typically have _______, whereas eukaryotes have _______.
    13·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • All of the scenarios are examples of evolution, with the EXCEPTION of the
    15·2 answers
  • Look at the diagram of the cell membrane. Would a cell membrane be able to function in the same
    10·1 answer
  • A condition in the brain, heart or other body arteries in which there is a bulge on the wall of the artery that can cause danger
    14·2 answers
  • The vagina is: A. lined by simple columnar epithelium rich in goblet cells B. similar to the inner lining of the uterus C. a mus
    15·2 answers
  • What is 3’ AGC GAT AAG 5’ as mRNA
    8·1 answer
  • Explain the complete process involved when a person makes a conscious decision to start jogging.
    5·1 answer
  • Question 10 of 32<br> Which of the following is true about sexual reproduction?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!