Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Explanation:
During transcription, DNA is converted into RNA in the nucleus of the cell.
Answer:
Disrupts the nitrogen cycle by contaminating the groundwater and making it more difficult for the plants to absorb the nitrogen and causes the phosphorus cycle to accelerate, resulting in an excess of phosphorus in water and soil.
Explanation:
Answer:
Nobody shall ever know -.-
Explanation:
Answer:
c. the specific geographical location where an organism lives.
Explanation:
The ecological niche of an organism includes the habitat where it lives and its place in the community with respect to the other species. It includes various adaptations present in the organism to survive in prevailing conditions, its interaction with other biotic factors of the system, and the pattern of consumption of available resources. Therefore, the ecological niche of an organism defines the space occupied and its functional role in the community irrespective of the type of biome. It does not take account of its geographical location on the earth.
