1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ostrovityanka [42]
3 years ago
15

Black jack (Bidens pilosa) belongs to the family Compositae. What is it’s: Genus.

Biology
1 answer:
AlladinOne [14]3 years ago
6 0

Answer:

<h2>Genus : Bidens</h2>

Explanation:

Bidens pilosa ( Black jack) is a species of herbaceous flowering plant .

Science has provided us with the following information :

Kingdom: Plantae

Clade: Tracheophytes

Clade: Angiosperms

Clade: Eudicots

Clade: Asterids

Order: Asterales

Family: Asteraceae

Genus: Bidens

Species: B. pilosa

You might be interested in
Which of the following is a character of a low pressure system
arlik [135]
D: it’s typically associated with cloudy weather and precipitation.
7 0
3 years ago
Read 2 more answers
Describe 1 attribute of a polar climate
leva [86]

Answer:

long cold winters, with annual temperatures mostly below freezing.

6 0
2 years ago
Read 2 more answers
Apply the principles of diffusion to explain what will occur after placing a dyed sugar cube in a beaker of water
snow_lady [41]

The molecules in the sugar move from an area of higher concentration (sugar cube) to an area of lower concentration in the water.

That is exactly what diffusion is: the net movement of molecules or atoms driven by a gradient , which means that it doesn’t requires energy.


7 0
3 years ago
Help ASAP! Very easy, 10 points and Brainly ,
Lapatulllka [165]

Answer:

yes. it's important to save the species that are closer to extinction first. the more critically endangered, the more important it is to save.

Explanation:

7 0
3 years ago
As newts' poison became more toxic, the garter snake's resistance to it became more efficient. This is an example of _____.
Contact [7]
To me, this sounds like the Garter Snake is becoming more immune to this toxic chemical.
5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Can you give me 5 chordates? preferably ones that live in oregon hhhh
    6·1 answer
  • Describe something you use every day that<br> was developed as a result of space<br> exploration.
    6·1 answer
  • Why do you think premenopausal women need more iron than<br> men of the same age?
    8·1 answer
  • Write three facts you discovered about stem cells
    15·1 answer
  • What is delta and how is it used
    9·2 answers
  • The lubber grasshopper is a very large grasshopper, and is black with red and yellow
    8·1 answer
  • The growth of organisms in an ecosystem can be limited by the amount of water and light the ecosystem receives.
    12·1 answer
  • Living things
    13·1 answer
  • Which best contrasts a bacterium and a virus?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!