Answer:
c) for
because it is describing about him
Answer:
Tuckman's model identifies the five stages through which groups progress: forming, storming, norming, performing, and adjourning. Each of the five stages of team development represents a step on the team-building ladder.
Explanation:
<u>Answer:</u>
Gerund phrase in the given sentence is ‘reading about history’.
<u>Explanation:</u>
A gerund are words formed with a “verb” ending with ‘ing’ but they act as nouns. For example: swimming, reading, drinking etc can be used as “gerunds”.
A “gerund phrase” will begin with gerund and include other objects and modifiers. The entire gerund phrase acts as noun in the sentence. For example, in the sentence, “I recommend reading books at home”, gerund phrase is ‘reading books at home’.
In the given sentence, gerund phrase ‘reading about history’, begins with gerund - ‘read’+ ‘ing’. It is acting as direct object here. If you ask a question, what Caroline loves? Answer is ‘reading about history’.
I think it would be a cow
Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.