1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
2 years ago
9

Bones provide attachments that allow skeletal muscles to cause movements? True or false

Biology
1 answer:
Tju [1.3M]2 years ago
7 0

Answer:

True ...........................

You might be interested in
Tor F: Prescription drugs and over-the-counter drugs are the same thing
vovikov84 [41]

Answer:

False

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the following would not be included in a description of an organism's niche? a. its trophic level b. its color c. the h
IRISSAK [1]

Answer:

C

Explanation:

This is because niche talks about tje role of an organism.

Considering the humidity of the organism is not given a role to the organism.

7 0
3 years ago
What type of energy is transferred during heating? a. thermal b. convective c. conductive d. temperate
Katena32 [7]

Thermal energy is transferred during heating.

What is thermal energy?

  • Thermal energy refers to the ability to do work. As such thermal energy can also be defined as the ability of something to do work as a result of the movement of its particles.
  • In other words, thermal energy is the energy possessed by an object or body by virtue of the movement of its constituent particles.
  • It is the total internal kinetic energy of an object due to the random motion of its atoms and molecules.
  • Thermal energy is a type of kinetic energy owing to the fact that it results from the movement of particles. Kinetic energy is the energy possessed by an object due to its motion.
  • Thermal energy forms the foundation of the study of heat energy and thermodynamics. It is one of the oldest forms of energy utilized by mankind.
  • Its usage existed even before petroleum and nuclear power sources were discovered.

To learn more about thermal energy: brainly.com/question/3022807

#SPJ4

4 0
1 year ago
Mama thinks that the condition of the barracks is no better than what _______ would sleep in.
Masteriza [31]

?

What is the topic? what is this question?

5 0
2 years ago
How does the potential volume of the pleural sacs change during inhalation?
exis [7]

<span>Pleural sac is a two layered membrane formed when a serous membrane known as pleura folds back onto itself. Thus, the pleura invest the lungs and line the walls of the thoracic cavity. However, the potential volume of the thoracic cavity increases during inhalation.</span>

4 0
3 years ago
Other questions:
  • I need some help on two homework questions in Biology:
    7·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Activation energy is
    8·2 answers
  • Compare plant and animals cells. What structures or processes do plant cells possess or perform that animal cells do not? Select
    12·2 answers
  • Cell division in prokaryotes Is called ___________.
    15·1 answer
  • • 3. Explain how the human eye possesses the featureof irredeemab complexity?​
    13·1 answer
  • Why flower produces only a small amount of nectar (food for insects) at a time ​
    14·1 answer
  • Saturated fats that are found in avocados are good and should not be limited.
    8·1 answer
  • 4. When a student cats a hamburger and then uses the energy from the
    8·1 answer
  • Label the lungs 1 - 11
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!