1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jasenka [17]
3 years ago
14

Using data from seismic waves, geologists have learned that Earth’s interior is made up of several what?

Biology
2 answers:
Mariulka [41]3 years ago
7 0
Is made up of several layers.
Andrei [34K]3 years ago
6 0
Geologist dicovered that Earth's interior is made up of several layers.  <span />
You might be interested in
Juanita sticks a nail to the end of a bar magnet. She then sticks a second nail to the first, then another to that one, and so o
Andreas93 [3]

Answer – The force of gravity is stronger than the force of magnetism.

 

The attractive force of magnetism is the force that keeps the nails joined to one another and to the end of a bar magnet while the force of gravity is the force acting to pull the nails to the ground. If when Juanita sticks the seventh nail, it falls off the sixth nail, it means that the force of gravity acting on the seventh nail is stronger than the force of magnetism acting on it.

8 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What happened to most freedmen after the Civil War?
jasenka [17]

Answer:

D. They rented farmland from white landowners.

Explanation:

5 0
2 years ago
Read 2 more answers
Four groups of scientists, in different parts of the world, are dating fossils found in a rock layer of the same geologic time p
Mnenie [13.5K]

Answer:

The options are

Complex

Identical

Inconsistent

Non-testable

The Answer is Identical

Explanation:

The groups of scientists in different parts of the world who are dating fossils found in a rock layer of the same geologic time period. The findings have to have some common characteristics which links it to being in the same geologic time period.

This however validates the fossils having to be identical to match those found in other parts of the world.

3 0
2 years ago
A(n) ________ is all living organisms in an area functioning together with nonliving factors of the environment.
Scilla [17]
The answer is (b.) ecosystem. An ecosystem is all living organism in an area functioning together with nonliving factors of the environment. An Ecosystem is a community of the living organism that includes the producers, the consumers, and the decomposers. 
8 0
3 years ago
Other questions:
  • Plz help I will mark you brainlist plz if it will let me but plz help me​
    9·1 answer
  • How are the respiratory system and the circulatory system connected.
    14·1 answer
  • Which of these actions should a city with a growing population take to address air pollution?
    15·2 answers
  • Air is primarily composed of Nitrogen and oxygen gases. Which state of these gases can conduct electricity?
    13·2 answers
  • Which planet is an inner planet and which is an outer planet
    12·2 answers
  • What is the meaning of life?
    13·1 answer
  • What are the effects of greenhouse gases on Earth?
    13·2 answers
  • What kind of species can harm an ecosystem or human health when introduced into the new environment? A species whose introductio
    9·2 answers
  • Which foods would contain mostly unsaturated fats
    10·1 answer
  • The advantage to the cell of the gradual oxidation of glucose during cellular respiration compared with its combustion to co2 an
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!