1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RUDIKE [14]
3 years ago
12

In rabbits, a recessive mutation in gene S results in animals with short-ears and a second unlinked recessive mutation in gene F

results in furless animals. Indicate the genotypes of the parents of the following crosses, a-d, in the space below
long ear long ear short ear short ear fur
24
30
15
8 25
29
4
9
(a) long ear, fur x short ear, furless
(b) long ear, fur x short ear, fur
(c) long ear, fur x long ear, furless
(d) long ear, furless x short ear, fur 10
Parent Genotypes Cross
(a): Cross
(b): Cross
(c): Cross
(d):
Biology
1 answer:
Nina [5.8K]3 years ago
4 0
I need help with this too
You might be interested in
The chart below shows rhe tree main types of plant tissues and associated tissues
Firdavs [7]
Hey where is the chart
6 0
3 years ago
The nurse manager on a psychiatric unit is reviewing the outcomes of staff participation in an aggression management program. wh
sergiy2304 [10]

The nurse manage of the psychiatric nurse can use surveys or questionnaires pertaining the aggression management program. These methods can be used in order to assess if the program was helpful.

8 0
3 years ago
Middle Column says net force equation.
yanalaym [24]

Explanation:

<em>h</em><em>e</em><em>y </em><em>is </em><em>it </em><em>full </em><em>question</em><em> </em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em>

<em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>.</em><em>?</em>

7 0
3 years ago
In humans, hair color and hair type are controlled by simple dominance. Brown hair (B) is dominant over blonde hair (b). Straigh
mart [117]

Answer:

These are the possible phenotypes of the offspring

3 0
3 years ago
Groundwater cannot be exchanged between aquifers and surface water.<br><br> True<br><br> False
elena-s [515]
The answer would be false
6 0
3 years ago
Read 2 more answers
Other questions:
  • When two pink flowers (rw) are crossed, there are four equally likely possible outcomes for the genetic makeup of the offspring:
    10·2 answers
  • Yo can someone help me out
    10·2 answers
  • What is one piece of evidence that some organelles like mitochondria and chloroplasts within eukaryotes used to be independent p
    8·1 answer
  • Match each statement to the type of behavior it describes. Jenna published the results of her latest experiment for the public t
    7·1 answer
  • What does mitosis produce <br> a. body cells <br> b. sex cells <br> c. dna <br> pls help me
    11·1 answer
  • ( 15 points! ASAP PLEASE ) Choose one of these two scenarios, and use the scenario to demonstrate the meaning of E = KE + PE. As
    14·1 answer
  • Why is the law of gravity an example of a universal law?
    6·2 answers
  • 3. Describe the technology that allows us to see beneath the surface of the Sun.​
    10·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Science, meiosis: Question and answers are in the photo below:
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!