1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuliya22 [10]
3 years ago
9

1. How does carbon enter the soil?

Biology
2 answers:
Katyanochek1 [597]3 years ago
7 0

Carbon moves from plants and animals to soils. When plants and animals die, their bodies, wood and leaves decays bringing the carbon into the ground.

tia_tia [17]3 years ago
6 0

Answer:

Carbon enters the soil through the decomposition of organic material.

Explanation:

Carbon moves from plants and animals to soils. When plants and animals die, their bodies, wood and leaves decays bringing the carbon into the ground. That’s why when humans burn fossil fuels to power factories, power plants, cars and trucks, most of the carbon quickly enters the atmosphere as carbon dioxide gas.

Hope this helps! :)

You might be interested in
Standard deviation refers to the __________. A. statistics used to organize, summarize, and describe sample data B. value within
lana [24]

Answer:

C. average distance between variable scores and the mean in a set of data

Explanation:

The standard deviation is used to find how far data points are from the mean. This can be used to create a bell curve, which represents what percentile data points are relative to the set. A bell curve shows how the data points are distributed. Standard deviation can be found from an entire data set or just a sample.

4 0
3 years ago
how do the processes of light dependent and light independent reactions help the cell conserve energy and matter
kari74 [83]

The alternation of processes help the cell conserve energy and matter. Light-dependent reactions produce ATP and NADPH, which used during Light-independent reactions to produce carbohydrates.

<h3>What are the final products of light-dependent and light-independent reactions?</h3>

Photosynthesis involves two stages: light-dependent and light-independent reactions.

  • Light-dependent reactions occur in the thylakoids.

During these, oxygen is released, while ATP and NADPH are produced. Both of them are used during light-independent reactions.

Photosynthetic pigments are in charge of light absorption.

When sunlight reaches the pigments, electrons get excited and move along the electron transport chain, placed in the thylakoid membrane.

As electrons get exhited, new electrons provided by water molecules replace the excited ones.

The final products are oxygen, ATP, and NADPH.

  • Light-independent reaction is known as the Calvin cycle, and it takes place in the stroma.

During the Calvin cycle, sugars or carbohydrates are synthesized.

When carbón dioxide, CO₂, enters the leaves through stomas, it diffuses to the chloroplast stroma.

Carbon atoms fixate, meaning that they incorporate into organic molecules. These molecules are used to produce 3-C sugars.

The whole process is impulsed by ATP and NADPH coming from light-dependent reactions.  

The alternation of the processes of light-dependent and light-independent reactions help the cell conserve energy and matter.

Plants takes solar energy and produce ATP and NADPH. When there is no available solar energy, the plant uses these molecules to produce carbohydrates.

You will learn more about light-dependent and light-independent reactions at

brainly.com/question/13585021

brainly.com/question/4004688

#SPJ1

3 0
2 years ago
Glaciers pick up large rocks and carry them away. This is called _____.
erma4kov [3.2K]

Answer: plucking

Plucking is a type of glacier erosion.Plucking occurs when the ice around the broken rocks, gets displaced with the force exerted by the retreating glacier. The glacier ice plucks the freezed rocks away along with it during glacier erosion.  

6 0
4 years ago
Which of the following is the best description of a control for an experiment?
makkiz [27]

Answer:

option 1

Explanation:

step by step

3 0
3 years ago
As sea levels rise, which of the following will affect marine biodiversity?
KiRa [710]

Answer:

Underwater plants will receive less light.

Explanation:

When sea level rises the amount of solar energy in the aquatic environment is decreased and this makes underwater plants receive less light and their development is impaired. This is because, with less sunlight, aquatic plants are unable to photosynthesize and absorb the carbon needed for their metabolism, thus end up dying and diminishing the plant diversity of the sub-aquatic environment.

In addition, many underwater organisms (such as some fish) feed exclusively on these plants. If these plants fail to grow, these fish will be without food and will eventually die; This will also cause problems for the diversity of the underwater environment.

3 0
4 years ago
Other questions:
  • When comparing bones from ancient fossils and modern bones--what is the primary technique do scientists use to compare the bones
    6·1 answer
  • 1.) Frequency measures the amount of waves that pass a specific point per second.
    12·1 answer
  • HELP I NEED HELP!! PLEASE???!!
    10·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of the following is an example of an ecosystem?
    12·2 answers
  • The Galapagos Islands are most famous for?
    10·1 answer
  • Which options describe Darwin's theory of natural selection? Select all that apply. Natural selection results in descent with mo
    5·1 answer
  • Irish Setters are type of dog. In Irish Setters, the allele for red coat color (R) is dominant over the allele for brown coat
    13·1 answer
  • Pls answer tyyyyyyyyy :)))))))<br><br><br><br><br><br> j
    15·2 answers
  • Who was in San Miguel de Gualdape, in addition to the colonists?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!