1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
2 years ago
11

Honey Bee:A.sexual reproduction.B.asexual reproduction.C.both.​

Biology
2 answers:
Bumek [7]2 years ago
6 0

Answer:

sexual reproduction

Explanation:

ICE Princess25 [194]2 years ago
3 0

Answer:

A

Explanation:

You might be interested in
Which of these is an example of an abiotic factor
Lilit [14]

Answer:

\boxed {\boxed {\sf B. \ Rocky \ desert \ soil}}

Explanation:

An abiotic factor is a part of an ecosytem, but it is not alive. Some examples include water, rocks, sunlight, and the atmosphere.

On the other hand, a biotic factor is a living part of an ecosystem. Some examples are animals, plants, and fungi.

Let's look at the answer choices.

A creosote plant (choice A) kangaroo rat (choice C) and coyote (choice D) are all living organisms. Therefore, they must be biotic factors.

However, rocky desert soil (choice B) is not living. It's a part of the ecosystem, but since it's not alive it must be <u>abiotic.</u>

4 0
3 years ago
Cells are produced with only one copy of chromosomes during meiosis II so:
blondinia [14]

Answer: c

Explanation:

jus took it

6 0
3 years ago
__________ forms a liquid cushion for cns structures. __________ forms a liquid cushion for cns structures. the pia mater cerebr
atroni [7]
Cerebrospinal Fluid

Produced by the choroid plexuses of the brain, the cerebral spinal fluid is contained in the subarachnoid cavity and spinal canal. It is reabsorbed by the arachnoid granulations.
Besides acting as a cushion for the CNS, the cerebral spinal fluid plays a critical part in the immunology of the central nervous system, blood flow in the CNS and autoregulation.

6 0
3 years ago
Mot nucleoxom co cau truc gom
sukhopar [10]
Sorry i didn’t understand
Sorry
7 0
3 years ago
Read 2 more answers
A valley is noticeably lower than the surrounding area. What is one way a valley might form?
ratelena [41]
Though erosion due to water
4 0
2 years ago
Read 2 more answers
Other questions:
  • What must every good hypothesis have
    10·2 answers
  • What best describes a carbohydrate?
    6·1 answer
  • f Javier has a car with a mass of 250,000 kg and it is acted upon with a force of 300 Newtons. What is the acceleration?
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • (1 pt) Why is DNA called the blueprint for life? A. It has the code to make carbohydrates. B. It stands for Director of New Acti
    9·2 answers
  • Explain the consequences of losses in biodiversity in an area.
    9·1 answer
  • Which of the following is not associated with prions?
    5·1 answer
  • What are the basic name of the elements that make-up a Macromolecule?
    9·1 answer
  • Suppose that one allele for an enzyme codes for a form that is active from pH 6.2 to pH 6.8 and another allele for this enzyme c
    13·1 answer
  • Secretin is released from the duodenum in response to.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!