1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
CaHeK987 [17]
3 years ago
7

What will most likely be the result if all of the mitochondria are removed from a plant cell? a it will be unable to carry out r

espiration. b it will lose water through osmosis. c it will break down the ribosomes in the cell. d it will be unable to photosynthesize?
Biology
1 answer:
masya89 [10]3 years ago
3 0
A it will be unable to carry out respiration.
You might be interested in
Which is a correct statement about mutations?
otez555 [7]
C. Because mutations are varieties
7 0
3 years ago
Describe natural selection- when does natural selection occur?
sashaice [31]

Answer:

The process whereby organisms better adapted to their environment tend to survive and produce more offspring. The theory of its action was first fully expounded by Charles Darwin, and it is now regarded as be the main process that brings about evolution.

Four conditions are needed for natural selection to occur: reproduction, heredity, variation in fitness or organisms, variation in individual characters among members of the population. If they are met, natural selection automatically results.

7 0
4 years ago
Blue poppies native to China were grown at a plant-breeding center in California. The plants with the thickest leaves were most
DIA [1.3K]

Answer:

Directional selection

Explanation:

Directional selection is a type of natural selection that favors one extreme phenotype of a genetic trait due to its survival and reproductive advantage to the individuals over another extreme phenotype and the intermediate phenotype.

In the given example, the thick-leaved plants are better adapted to a drier climate due to reduced water loss. Directional selection favored the plants with thick leaves which in turn produced more progeny. Over the generations, the population evolved into the one having more number of thick-leaved plants.

8 0
3 years ago
What is a population?<br> Answer
velikii [3]

Answer:

A population is the number of living people that live together in the same place. A city's population is the number of people living in that city. These people are called inhabitants or residents. ... Usually population refers to the number of humans in a certain area.

Explanation:

Hope this help

3 0
4 years ago
Read 2 more answers
A client reports a severe, sharp, stabbing headache and intense pain in and around the eye that lasts for up to 1 hour. history
Basile [38]
Answer:
Rhinorrhea
Lacrimation
Pupillary constriction

The diagnosis for the patient seems to be a cluster headache. In a cluster headache, the patient will have an intense pain with lacrimation, rhinorrhea, and miosis(pupillary constriction). The pain is unilateral with duration of minutes to hours. It could occur for weeks and <span>disappear </span>for months afterward, makes it called "cluster".. 
4 0
3 years ago
Other questions:
  • What is the meaning of transpiration?
    10·2 answers
  • Help me pls, What is cellulose used for?
    12·2 answers
  • Which of the following things are clues that a chemical change has taken place?
    8·1 answer
  • The picture below represents an atom of the element nitrogen.
    7·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Organisms use different types of adaptations to aid in their survival.Which of the following is an adaptation that would not hel
    7·2 answers
  • Define the term excretion.
    6·1 answer
  • Two frog populations (same species) living in two neighboring lakes sing slightly different courtship songs. Increased irrigatio
    13·1 answer
  • The soil will move farther when you pour water_________<br><br>gradually or rapidly<br><br>​
    5·1 answer
  • Students are learning about plate tectonics and how current topographic features were formed. The students learn
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!