Four conditions are needed for natural selection to occur: reproduction, heredity, variation in fitness or organisms, variation in individual characters among members of the population. If they are met, natural selection automatically results.
Ur welcome
Answer:
I think its letter d........
Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
Answer: what it basically states is than an object in motion will stay in motion until something stops it, whether that be the wind slowing it down, friction, a person, or a wall. For example - when you throw a ball, several forces are acting on it that stop it from going forever. Gravity is pulling the ball back to the ground and the wind/ air is pushing against it as well. Thats why if you throw a ball in space it will continue going forever since gravity and air arent acting on it .
Answer:
D) Two of her sons have hemophilia and one does not.
Explanation:
The fact that Waldemar (her son) was hemophilic, is the best evidence to prove that Irene was heterozygous for hemophilia. Walderman received the Y chromosome from his father and an X chromosome from his mother. The X chromosome that he received from his mother carried the recessive allele for the trait, and this is why he had hemophilia. This means that there is no best evidence for Irene´s genotype than her son´s genotype.
I hope it helps you!
