1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MariettaO [177]
3 years ago
13

What is (are) the target organ(s) of a gonadotropin?

Biology
1 answer:
zepelin [54]3 years ago
3 0
An anterior pituitary gland
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which pair of microscope views represents a eukaryotic cell and prokaryotic cell?
pickupchik [31]

Answer: it might Be C or B

Explanation:

7 0
2 years ago
The sequencing of mitochondrial dna to trace changes in human ancestors over time involves which specialization of anthropology?
WARRIOR [948]
For the answer tot he questions above, the answer is "paleoanthropology"

It is also called human paleontology. It is a <span>branch of anthropology that is concerned with the origins and development of the early humans.
I hope my answer helped you.
</span>
5 0
3 years ago
Read 2 more answers
Potential energy is
Aleksandr [31]
I believe it is A- Stored Energy.
5 0
3 years ago
Read 2 more answers
True or false: A spider web is considered a biotic factor<br> A. True<br> B. False
Kipish [7]

Answer:

i think a sorry if its wrong!

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following is NOT a
    11·2 answers
  • Why is gene regulation necessary in the development of multicellular organism? Use a specific example to support your argument
    15·1 answer
  • Identify the compound that plants make to store as energy
    5·2 answers
  • Scientific research shows that Earth's climate is changing due to human
    13·1 answer
  • Which element would you expect to have a full valence shell?
    11·1 answer
  • The genotype of persons with the sickle-cell trait, but often not exhibiting sickle-cell, is .
    10·1 answer
  • Help mee plz i dont have time​
    11·2 answers
  • What structure holds the two sister chromatids together as they prepare for cell division.
    7·1 answer
  • How is the blending theory of inheritance useful in genetics?
    9·1 answer
  • The body monitors the levels of oxygen in the blood to regulate breathing. Isabel is running in a marathon and is near the finis
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!