I'll try to explain, because I've had tubes before. In fact, I still have them.
For me, tubes were put in because of too many ear infections, and excessive water in my ear. The tube helped drain the water out. You can see A picture I have in a file. The tubes can be put I believe in the ear drum. They're put there to help drain water that has trouble getting out on its own.
Answer:
The moths were typically white with black speckles, which helped them blend in. There was a mutation that caused some of them to be almost entirely black, which would make them easier to spot and get eaten. However, one event that left the trees covered in ash and soot was an advantage for these moths. They blended into the trees more so than the other ones, and there was a giant fluctuation of them. The mutated ones now had a better chance of staying camofluaged, and the white and black speckled ones were more likely to get eaten.
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Water molecules have covalent bonds. Each molecule consists of two hydrogen and oxygen covalent bonds. However, when water molecules are placed together, as they are normally, the hydrogen atoms in each molecule can form hydrogen bonds with the oxygen atom of other molecules.
I think it’s C because if you’re allergic to one cillian than you’re allergic to all of them
Sorry if this is wrong
