1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ad libitum [116K]
3 years ago
12

The smaller a population of organisms of a particular species, the

Biology
1 answer:
Ksju [112]3 years ago
7 0

Answer:

The correct answer is - D. less likely natural selection is to affect the population

Explanation:

The larger population of a species tends to produce more mutant individuals per generation than a smaller population per generation. In a larger population, it assists to get more genotypes and gets optimal genotypes quicker than smaller populations.

In larger populations, the process of natural selection is more effective and for the smaller population   Second, natural selection is less likely to affect the population which leads to less genetic diversity or change in order to survive due to stochastic sampling error  as some allele loss in random selection.

You might be interested in
Antoine Henri Becquerel was a French physicist who did a lot of work with fluorescent minerals. While conducting some experiment
grandymaker [24]

radioactivity,

i jst gdid it :D

6 0
4 years ago
Read 2 more answers
The process which causes potholes in roads is called ______ when it occurs under glacial ice
Fofino [41]

Answer:

Expansion and Contraction of underneath or base water

Explanation:

When ice lands on a road, it weakens the soil beneath the pavement, cement by expansion. The slight varying temperatures that leads to the combination of contraction and expansion affects road this leading to potholes on road.

4 0
4 years ago
Read 2 more answers
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Which statement best describes the function of the human body system in the above diagram?
seropon [69]

Suministra oxígeno a la sangre y elimina el dióxido de carbono de la sangre

4 0
3 years ago
Sombody who knows science good help me
zhannawk [14.2K]

Answer:

I can help at anytime, but I don't know how to contact you with brainly.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • 2. Two Dalmatians had a large litter of 10 puppies. Seven of them have black spots, while 3 do not. What would the genotypes of
    13·1 answer
  • How has kosh’s postulates helped improve modern medicine
    12·1 answer
  • Which event marks the beginning of DNA replication?
    11·2 answers
  • Which molecule can be hydrolyzed?
    9·1 answer
  • Rough ER is connected to the system membrane and to
    10·1 answer
  • Which part of a nerve cell do electrical signals travel down?
    13·1 answer
  • The Earth experiences seasons because it is tilted 23.5* as it revolves around the Sun. This causes the northern or southern hem
    12·2 answers
  • What occurs in the life cycle of a moss but not in the life cycle of a gymnosperm?
    9·2 answers
  • Most superior part of the<br> sternum
    14·1 answer
  • Your New Year's resolution is to drastically reduce the amount of cholesterol in your diet by eating less meat and more fruits a
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!