1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dafna1 [17]
3 years ago
9

What states can I legally own a pet bat?

Law
2 answers:
Vera_Pavlovna [14]3 years ago
7 0

Answer:

Florida, and that's all I found.

Explanation:

Katarina [22]3 years ago
5 0

Answer: Alabama, Nevada, North Carolina, and Wisconsin! A bat in the wild can live up to 30 years while only a few pet bats will make it to a year. Bats need special care, housing, and nutrition. While you should always treat any bat you come into contact with as a wild animal, they are really gentle in nature. They aren't going to bite you to suck your blood. This is why when bats are startled they tend to flock out of that location as swiftly as they can. They don't try to attack humans on their way through.

Explanation: I am pretty sure these are the places you can keep exotic animals such as bats! Have a good day!!!! Hope you get a bat :)))

You might be interested in
Steps a civil case might go through in a state court system
maks197457 [2]
Trials in criminal and civil cases are generally conducted the same way. After all the evidence has been presented and the judge has explained the law related.
7 0
2 years ago
Read 2 more answers
Locke’s purpose in examining the “state of Nature”is
NNADVOKAT [17]

Answer:

D)To show why the state of nature is inadequate for determining what our fundamental rights should be.

Explanation:

John Locke, an English philosopher, widely referred to as Father of Liberalism, examines the "State of Nature" for the purpose of showing why the state of nature is inadequate for determining what our fundamental rights should be.

According to him, each individual in a society has a natural right to protect his or her own life, liberty, and property and at the same time, each individual has a natural right to seek for compensation for any wrongful injury to his or her natural rights; life, liberty, or property which has been inflicted by other individuals.

However, Locke, believed that, since 'state of nature' is more or less a state of insecurity, that is, each individual is not secured to possible infringement of his or her natural rights by other individuals. Hence, the needs to create a civil government, whose purpose is to protect the natural rights, freedom and well-being of all members of society.

This is because, in a "state of nature" there is no legislative or judicial authority that members of the society can seek for help in order to protect their natural rights, such as lives, liberty, or property. But to ensure there is security and protection to individuals natural right, there is need for a civil government, with a judicial authority whose purpose is to resolve disputes fairly and equitably.

7 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
A reflection on the key values of the social work profession
frozen [14]

Answer:

service, social justice, dignity and worth of the person, importance of human relationships, integrity, and competence.

Explanation:

tama po to..

5 0
3 years ago
States are required to support the laws and court decisions of other states, as laid out in which clause of the United States Co
Annette [7]

Answer:

I think 3

Explanation:

6 0
2 years ago
Other questions:
  • Given AB | | DE. Triangle A B C. Side A B is 12 miles and B C is x miles. Triangle C D E. Side C D is 6 miles and D E is 8 miles
    11·2 answers
  • How to you think race is or is not related to the police use of force? What do you base your opinion upon?
    14·1 answer
  • Which of the following actions can a union take to get an employer to submit
    7·2 answers
  • What are the elements of an arrest?
    10·2 answers
  • Legislative Branch
    5·1 answer
  • Hundreds of agencies that help the Secretaries of each
    6·1 answer
  • 4. What is one downside of federalism?
    11·1 answer
  • In court cases the ________ is the party that brings charges and the ________ is the party accused of a violation of the law.
    12·1 answer
  • By law, everyone must contribute the maximum amount into their 401(k) plans at work. Question 4 options: True False
    9·1 answer
  • The conversation below took place between two U.S. citizens.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!