1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kumpel [21]
3 years ago
13

Different cell types and tissues express different sets of genes; for example, some genes are expressed primarily in the heart,

others primarily in the brain, and still others primarily in the liver. This is possible because all of these cell types have ____________.
a. different sequence variants that control gene expression
b. different ordering of genes on chromosomes
c. different histone and DNA modifications
d. different sets of genes
Biology
1 answer:
Kobotan [32]3 years ago
5 0

Answer:

d.Different sets of genes.

Explanation:

A cell normally only expresses a percentage of its genes and various cell types are created by the expression of distinct gene sets. In addition, in response to changes in their environment, cells can alter the pattern of genes they express, such as signaling from neighboring cells.

You might be interested in
What doctors do plant cells have that animal cells don't have?
ira [324]
<span>lysosomes and centrioles </span>
4 0
4 years ago
Which organ has the most chloroplast and why?<br><br>A. Roots<br>B. Stems<br>C. Leaves
Harlamova29_29 [7]
The leaves because that's what has most green.So they have more pigments to produce chloroplast.
3 0
3 years ago
Read 2 more answers
Can someone answer these questions for me pleaseee!! 20pts​
galben [10]

1. (Carnivorous) They don't rely as much on the mechanical breakdown of foods in the mouth as much as they usually eat their prey whole. They also have U-shaped stomachs.They regurgitate indigestible things (e.g. Large Bones). They have shorter, spiralling intestines, but this means it also has a large surface area.

2. One difference is that humans have lungs so that is used to oxygenate the blood while shark has gills. Another difference is that Sharks use the heat from their muscles, so rather then expelling it into the outside environment that actually use that to heat their blood and transfer the heat from warmer blood to passing colder blood.

3. I positioned my shark to be dorsal side up and have its ventral side facing down.

4. The pectoral girdle is in a location where the cartilage is very thick.

7 0
4 years ago
Read 2 more answers
Which organelle in the plant cell would mainly help the cell take water or get rid of water
victus00 [196]
 The answer is Vacuoles. After water enters this cell through the osmosis, it expands to absorb water and contract to release it.
3 0
4 years ago
A girl found the skull of an animal. She didn't know what the animal was, but she was sure it preyed on other animals for its fo
VMariaS [17]
When you don't know whether an animal was once a Carnivore, Omnivore, or Herbivore, all you have to look for is the teeth. Carnivores have long canines, as well as overall sharper teeth, while omnivores and herbivores contain flat molars. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • A bovine-derived enzyme used as a chemical method of hemostasis is
    15·1 answer
  • When plate movement causes rocks to break, it's called
    5·1 answer
  • The somatic nervous system ______.
    5·1 answer
  • Help lolllllllll HAHAHHAHAHAHAHHAHAHAH
    11·1 answer
  • Label the images below with 1-4 from least developed to most developed.
    5·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Which term does not name a domain of life? A: Archaea B: Bacteria C:Protista D: Eukarya
    6·2 answers
  • PLSSSS HELPPPPP HELPPPPP
    5·2 answers
  • What disease can result from uncontrolled cellular division?
    9·2 answers
  • The human body has many types of cells. For example, muscle tissue and skin have different kinds of cells.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!