1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tekilochka [14]
3 years ago
12

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Biology
1 answer:
mote1985 [20]3 years ago
4 0

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

You might be interested in
All of the following are examples of limiting factors except
elena-14-01-66 [18.8K]

Answer:

soil is the answer

6 0
3 years ago
Jackrabbits living in the desert have large ears that help release body heat. Large ears are an adaptation to which is limiting
Cloud [144]

Answer:

It is the adaptation to the limiting factor temperature.

Explanation:

The presence of long ears is the most astonishing characteristic of jackrabbits. These long ears are the jackrabbits' adaptation to their native desert habitat, which helps them to cool down the temperature of their body. The ears allowed them to do so as they are thin and possess an extensive mass of blood vessels. When the temperature of the desert becomes hard to hands, the long ears of jackrabbits allow them to enhance the flow of blood via the ears by dilating its blood vessels. This dilation helps to deflect heat from the body and thus cools the creature.

4 0
3 years ago
Any one want to talk? so bored
shtirl [24]

Answer:

me too

Explanation:

5 0
3 years ago
Why is spotify still streaming when i have cell data off.
fgiga [73]
I really don’t know that’s really confusing... do you still have Internet or do you have self internet turned on?
3 0
2 years ago
The LPN/LVN cares for a client newly diagnosed with paranoid schizophrenia. The client tells the LPN/LVN, "There are really stra
vovikov84 [41]

Answer:

4. "Sometimes when people are upset, their imagination plays tricks on them."

8 0
4 years ago
Other questions:
  • The rate at which your body consumes food energy to sustain basic functions is your: Group of answer choices Basal metabolic rat
    12·1 answer
  • What is the term used for a farmer growing crops but using it for self gain?
    8·2 answers
  • Choose 3 examples of inventions that were inspired by nature. Write a short paragraph about each.
    15·1 answer
  • Doctors sometimes use a vaccine to help prepare the body to defend itself against future infections. These vaccines most often c
    6·2 answers
  • Which diseases don’t yet have vaccinations? What are the reasons?
    9·1 answer
  • Suggest how a platypus adapt to its habitat​
    15·1 answer
  • Are you against GMO foods? If so please right a paragraph below explaining why you are against it! DO NOT COMMENT IF YOU ARE ONL
    8·2 answers
  • Which cell is a plant cell?
    8·1 answer
  • PLEASE HELP I WILL MARK BRAINALISTTTT
    7·1 answer
  • Where do virus grow ? what they cause ? <br>​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!