1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alisha [4.7K]
2 years ago
5

Which of these is the BEST way to assure a healthy animal stays healthy?

Biology
1 answer:
Vsevolod [243]2 years ago
6 0
The answer is D. Have a great day
You might be interested in
Why do innie belly buttons pop out during pregnancy, but not weight gain?
Vitek1552 [10]
Because while you're preagant your have so much presure on it it doesnt have a choice where as weight gain everything grows with it. Think of it this way, if you've ever felt a pregants womans belly its harder than usual. If you touch someones belly that is bigger its more smoshy (I know thats not spelt right)
4 0
3 years ago
What three cell parts act like as assembly line to produce and distribute proteins?
SOVA2 [1]
I'm not sure if this is correct, but the answer I got was: endoplasmic reticulum.

I hope this helps, and have a good night! :D
6 0
3 years ago
Read 2 more answers
What do the migration routes of homo sapiens reveal about their survival skills and ability to adapt?
garik1379 [7]

<span>The migration routes of Homo sapiens reveal that they went through many environmental and physical challenges but adapted everything much quickly in comparison to the other animals. The evolution allowed other species also to adopt these changes but it took them a long time to fit in the new environment, a sub species of a species adopted the new and the previous one could not, but Homo sapiens invented ways and tools to combat and evolve much quickly. It included their living, dietary needs, clothing and much more.</span>

5 0
3 years ago
Which gland would a doctor check if a person didn't react to stressful situations
Inessa05 [86]

Pituitary gland.


When you feel stress, the pituitary gland, at the base of the brain, increases its production of the hormone ACTH. This hormone tells the adrenal glands, found at the top of your kidneys, to increase their production of hormones. These stress hormones help you to concentrate, speed your reaction time, and boost your strength. Your hypothalamus also helps your body respond to stress.

5 0
3 years ago
Read 2 more answers
Which statement is true about gold and helium
RideAnS [48]

Answer:

needs more info to be answered could you state them down or put a pic

Explanation:

4 0
3 years ago
Other questions:
  • Ecology is the study of the differences between plants and animals in their environment
    10·1 answer
  • Why is fermentation such an important process in cells?
    15·2 answers
  • Which statement best describes how the distance from a large river affects
    5·1 answer
  • Name two types of evidence used to support the theory of evolution. Explain how scientists use each type of evidence to provide
    9·1 answer
  • Is Exothermic/Endothermic related to Product/Reactant Favored?
    6·1 answer
  • Which condition is commonly treated with a fasciotomy to relieve pressure?​?
    9·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Whoever is good with biology help me please and thank you
    12·2 answers
  • Although male and female reproductive structures differ from one another in many ways, they carry out some of the same functions
    13·1 answer
  • Write a brief explanation of the rock cycle in your own words.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!