1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masha68 [24]
3 years ago
7

Which of the following is another way to refer to sex cells

Biology
2 answers:
emmasim [6.3K]3 years ago
6 0
It’s gametes I just did this unit
Andrej [43]3 years ago
4 0

Answer:

a

Explanation:

zI did this the other day.... pretty weird but ok!!!!

You might be interested in
A unique feature of muscle tissue is that it is capable of
kogti [31]

Answer:

Contraction.

Explanation:

Muscle tissues are defined as they are elastic and extensible in nature. In other words it's also defined as they are able to stretched and returned to its original size and shapes. A unique feature of muscle tissue is they are able of contractile in nature. With the help of this contraction they are able to sliding myosin and actin filaments which are present in muscles tissues.

Basically muscle tissues are three types:

1) Skeletal muscle: They are strong and rapid in contraction.

2) Cardiac muscle: They are strong in contraction.

3) Smooth muscle tissues: They are slow and weak in contraction.

4 0
3 years ago
DNA stands for which of the following?
Andre45 [30]

Deoxyribonucleic acid.

5 0
2 years ago
Read 2 more answers
12. If an ecologist is looking at how many individual organisms live within a certain population, he or she is studying the popu
sukhopar [10]

The answer would be C or Population Density

7 0
3 years ago
Read 2 more answers
In order to be a female who will go bald, what mass genotypes types of her parents be
olganol [36]

Answer:

a person duhhhh

Explanation:

4 0
3 years ago
Which organisms are most critical in the nitrogen cycle?
Strike441 [17]
These are the things that convert nitrogen in the soil -cyanobacteria<span>participate. After nitrogen has been fixed, other </span>bacteria<span> convert it into </span>nitrate<span>, in a process known as nitrification.</span>
8 0
3 years ago
Other questions:
  • According to some botanists, invasive plants are the second most serious threat, after habitat loss, to native species of plants
    15·1 answer
  • Give three examples of of potential energy converted to kinetic energy.
    13·1 answer
  • Stomatas are pores on the plant leaf that
    9·1 answer
  • If heated with the same amount of energy and under the same conditions will soil or water cool faster?
    15·1 answer
  • 3) What type of rock are fossils usually found in? Explain
    6·1 answer
  • What human activity contributes to air pollution?
    6·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 10
    13·1 answer
  • Which of the following is a solid non metal a carbon b sulphur c Phosphorus d all of these​
    15·2 answers
  • The absorption of human-generated co2 by the oceans __________.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!