1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dezoksy [38]
4 years ago
13

In what organism would you find cell division being completed by cytokinesis, a process in which a new plate forms between two d

aughter nuclei?
Question 48 options:

animal

bacterium

plant

protist
Biology
1 answer:
emmainna [20.7K]4 years ago
3 0

Answer:

Plants

Explanation:

In animal cells the division of cytoplasm is by constriction of the cell membrane. But in plant cells a cell plate forms within the cytoplasm and grows to separate the cell into two. The cell division in plants is completed by cytokinesis.

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
A trait I which the alleles are not dominant over one another
JulsSmile [24]

Answer:

They are co-dominance and incomplete dominance.

<h2 />

Explanation:

Co-dominance occurs when both alleles in a heterozygous genotype for a trait are both equally expressed. An example is the human AB blood group, in which both the A and B alleles are equally expressed.

Incomplete dominance occurs when the heterozygous genotype for a trait is expressed as a blend. An example is blue feather color in chickens, in which a black allele and white allele together are expressed as blue feather color.

3 0
2 years ago
How might the graph change if the environmental conditions of bacteria suddenly change
vaieri [72.5K]
Can i get a picture of the question
6 0
3 years ago
Chloroplast structure and function
Lana71 [14]

Answers:

A) The membranes of the Chloroplast are the  

1) Thylakoid membrane 2) Envelope membrane

B) Calvin cycle occurs within the stroma, while light reactions occur within the thylakoid membrane.

Explanation:

Generally, the chloroplast is made up of the; <u>Thylakoid membrane and Envelop membrane</u>. The thylakoid membrane is basically the region for light absorption, thus making it the site for light reactions within the chloroplast.  

Calvin cycle, which occurs in the stroma, involves light independent reactions. It occurs shortly after the light-dependent reactions, and further breaks down ATP and NADPH, products of the light reactions.

The stroma is located outside the thylakoid membrane.

For the remaining listed organelles:

1) The Cytosol- It’s the liquid space within the cell. The chloroplast can be found floating within the cytosol of any involved plant cell.

2) Thylakoid space- The space within the thylakoid.

3 0
3 years ago
Which is true of both DNA and RNA
Marizza181 [45]
The answer for question 1 is (C)


5 0
3 years ago
Other questions:
  • Contrast the different types of soil particles
    6·1 answer
  • What is the process in which plants use sunlight energy to make glucose?
    9·1 answer
  • When was Magna Carta written
    9·2 answers
  • Thin skin contains ________ layer(s of keratinocytes, and thick skin contains ________ layers.
    11·1 answer
  • In a signal transduction pathway, fine tuning of the cellular response occurs in several steps. Which of the following best desc
    10·1 answer
  • Which of the following is a product of dehydration synthesis?
    8·1 answer
  • Why are ferns and mosses poorly adapted to a terrestrial life​
    13·1 answer
  • Which of the following is an interaction in which one organism benefits and the other is unaffected?
    13·2 answers
  • A proton gradient is an important part of both photosynthesis and cellular respiration.
    6·1 answer
  • Why it is important to place the gel in the correct direction in the gel cassette while running it?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!