1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
12

The difference 25(d−10)−23(d+6) is?

Mathematics
1 answer:
Nonamiya [84]3 years ago
3 0
<h2>Answer:</h2><h2>2d - 388</h2><h2></h2><h2>Hope this helps!!</h2>

You might be interested in
URGENT TEST IN ONE HOUR, NEED HELP For 35 points: A drone is flying at a speed of 40 miles per hour in the direction of S70°W. T
VashaNatasha [74]

Answer:

this is confusing

Step-by-step explanation:

8 0
3 years ago
Ashton is thinking of a number. When she divides it by 7, she gets a quotient of 7.35. What number is Ashton thinking of?
shutvik [7]
Take 7/7.35oijoijijioj
3 0
3 years ago
Read 2 more answers
Which composition of transformations below will map figure K onto figure S and then onto figure U?
Dmitrij [34]
Ok from the given the best choice to go with will be option B because its going from an up right and its going to flip and rotate.
3 0
2 years ago
Read 2 more answers
Please assist me with these proofs part 2​
Irina18 [472]

Answer:

5- ASA

6- SSS

7- SAS

8- SSS

Step-by-step explanation:

4 0
3 years ago
Which label on the cone below represents the height​
Allisa [31]

Answer:

The tall side

Step-by-step explanation:

8 0
3 years ago
Other questions:
  • mr. Johnson was paid $190 for a job that required 40 hours of work. At this rate how much should he be paid for a job requiring
    8·1 answer
  • Can anyone help me with this?
    10·1 answer
  • The expression (8^2)^3 in the example problem is a product of powers. What are the powers being multiplied? What are the powers
    5·1 answer
  • Can someone help....​
    10·2 answers
  • Independent variable vs dependent variable example
    7·1 answer
  • Wei has $150.00 to make a garland using 60-cent balloons. He wants to purchase 100 blue balloons and some number of white balloo
    5·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • a cloth bag holds 4 letters a,e s and t. elliot selects a tile at random, one at a time. what is the probability that he selects
    10·1 answer
  • Faris wrote this equation to represent a real-world situation.
    7·1 answer
  • the longer leg of a right triangle is 4 cm longer than the shorter leg. the hypotenuse is 8cm longer than the shorter leg. Find
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!