1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weqwewe [10]
3 years ago
8

Which statement represents an abiotic environmental factor in an ecosystem? The plant has flower buds every spring. The fish swi

m up the river to reproduce. The fox eats mice in the meadow. The lake bottom is lined with rocks.
Biology
2 answers:
qaws [65]3 years ago
5 0
The last sentence is correct.

please vote my answer brainliest. thanks!
BaLLatris [955]3 years ago
4 0

Answer:  The lake bottom is lined with rocks.

Explanation:

Abiotic factor environmental factor is the non-living factor of the ecosystem on which the living  beings are either influenced by or are dependent upon for their basis needs such as air is required for respiration, water is required to fullfil thirst and sunlight is important for photosynthesis.

The lake bottom is lined with rocks. is the correct option because rocks define the abiotic factor.

You might be interested in
Poor diagnostic reasoning and illusory correlations have been documented in all of the following cases EXCEPT individuals with c
belka [17]

Answer:

All of the above individuals demonstrate these errors

Explanation:

7 0
3 years ago
I NEED HELP AAAAAAAAAAAAH.
agasfer [191]
Me tooooooooooooooo but it’s okay because a
6 0
2 years ago
Which feature of Earth is part of the geosphere?
notka56 [123]

Answer:

Rocks

Explanation:

Geo means “earth.” The Earth’s geosphere (sometimes called the lithosphere) is the part of the Earth that includes all the rocks, minerals and landforms of the surface and interior that make up the Earth. It starts at the ground and extends all the way down to Earth’s core.

8 0
3 years ago
Read 2 more answers
Gametes are diploid<br> True<br> False<br><br> HELPP
bogdanovich [222]

Answer:

false

Explanation:

gametes are haploid while they fuse together to form a zygote that would be diploid

5 0
3 years ago
Which best describes what is happening in the area marked y
Zigmanuir [339]

Answer:

Oxygen is being released through the Stomata

Option (A)

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following choices reflects the appropriate order of locations through which a protein destined for the plasma membr
    10·1 answer
  • Who was the first person to develop the ideas of listing elements according to their mass?
    7·1 answer
  • DNA replication involves producing new copies of DNA molecules. How many individual DNA strands exist after one molecule of DNA
    10·2 answers
  • What is the best definition of the term imagery?A student completed a lab report. Which correctly describes the difference betwe
    6·2 answers
  • Use the drop-down menus to identify if each phrase describes a feature of a map, a globe, or both.
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Organisms that are most likely to use evaporative cooling would be ____________.
    14·1 answer
  • What are two common pollutants?
    9·1 answer
  • 2.2. Which of the following is NOT a type of animal hair which may be found at a crime
    8·1 answer
  • One primitive trait of Ardipithecus ramidus is its Group of answer choices opposable big toe flat face. pelvis. hip. PreviousNex
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!