All categories

2 years ago

As you have been working in class today, the breathing center in the brain responds to the level of carbon

Biology

2 answers:

olga2289 [7]2 years ago

3 0

Answer:

In the lungs breathing can be easier when not filling it with unnecessary toxins, the consequences of people at high altitudes slow asphyxiation if the altitude is high enough, headaches, hallucinations, blackouts and other symptoms if it's not as extreme.

PLEASE MARK BRAINLIEST IF CORRECT, I WORKED HARD ON THIS ANSWER. HAVE A GOOD DAY/NIGHT <3

Dennis_Churaev [7]2 years ago

3 0

Answer:

What she said

Explanation:

I hate typing :c

You might be interested in

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Ribonucleotide reductase controls the synthesis of deoxyribonucleotides and the balance of nucleotides in the cell. The R1 subun

aliya0001 [1]

Answer:

ATP and dATP

Explanation:

In the R1 subunit of ribonucleotide reductase, molecules that binds the site regulating overall ribonucleotide reductase activity include both ATP and dATP. In addition, binding of ATP can activate ribonucleotide reductase and the binding of dATP deactivates ribonucleotide reductase.

3 0

3 years ago

Match each underlined word to its correct meaning based on the context of the sentence. Tom had long been picking his way cautio

olasank [31]

Answer:

A. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. - 3.dangerous.

B. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. - 4.bleak.

C. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. - 2.conciliatory.

D. At this propitious time of public distress did Tom Walker set up as a usurer in Boston. - 1.favorable .

Explanation:

The given underlined words in each sentence are-

1. "Precarious" refers to something unstable, unconfirmed, dangerous, uncertain, unreliable. So, when used in the given sentence, it suggests the dangerousness of the foothold that Tom had to depend on.

2. The word "dreary" is also used for something dull, uninteresting, bleak. It is used to describe the banal, cheerless memento of the fight the Indian warriors had given.

3. "Propitiatory" is another word used to describe something that is like a conciliatory offering, a token of appeasement, or trying to please someone or something. In the given sentence, it is used to describe how she will be offering a conciliatory act to him.

4. The word "propitious" is synonymous with something favorable, advantageous, presenting a promising idea. And in its use, the sentence presents how the public distress is favorable for Tom Walker to set up his office.

8 0

3 years ago

What is the niche of slime molds and other decomposers?

Schach [20]

They break down the organic matter that has died so that the nutrients stored with in it can be reused.

3 0

3 years ago

Which scientist devised tests that helped confirm that bacteria and other microorganisms cause a variety of diseases?

leva [86]

Answer:

Louis Pasteur was the scientist who confirm that bacteria and other microorganisms is the reason for variety of diseases.

5 0

3 years ago

Read 2 more answers