1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
3 years ago
14

I need help assay about Biopsychology can someone help me?

Biology
1 answer:
VMariaS [17]3 years ago
4 0
<h3>Core assumptions of the biopsychological approach</h3>

⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂

✍︎ The core assumption of a biopsychological approach is the fact that illness and health come as a result of a given interplay. In this case it should be known that this interplay revolves around factors like psychological, social and even biological aspects. Most notably, there is always an initiative and attempt to understand the aspect of psychopathology that is done through proper examining.

⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂⁂

꧁❁ ⁱ ʰᵒᵖᵉ ⁱᵗ ʰᵉˡᵖˢ ❁꧂

You might be interested in
How do enzymes affect the activation energy of a reaction
Kitty [74]
Catalysts lower the Activation energy for reactions. The lower the activation energy for a reaction,the faster the rate. Thus enzymes speed up reactions by lowering activation energy. Many enzymes change shape when substrate ms bind.
3 0
3 years ago
Which criterion is not used to describe a mass movement event?
Ede4ka [16]

Answer: The angle of the slope

3 0
2 years ago
What types of materials are expelled from cells during exocytosis?
alex41 [277]

Large molecules such as hormones materials are expelled from cells during exocytosis

<u>Explanation:</u>

The materials inside the cells are transferred to the outside of the cell and this manner is termed as  Exocytosis. This method is termed as a kind of active transport since it needs energy for this transformation process. One of the major purposes of this process is to discharge trash matters like hormones and proteins.

For a cell to cell transmission and chemical signal messaging these methods are essential. Proteins that are newly generated are transferred to the peak of the plasma membrane by exocytosis. There are three general pathways of exocytosis.

5 0
4 years ago
What law best explains why an organism with Tt will show only the dominant phenotype
nirvana33 [79]

This is the law of dominance in genetics. The dominant allele will mask the effects of the recessive allele and therefore will be the visible trait of the phenotype. Most often, the dominant allele codes for functional proteins, while the recessive does not code for functional proteins. Dominance in genetics is significant in Mendelian inheritance.  






4 0
4 years ago
Read 2 more answers
This biome has cactus plants, less rainfall, and more sand. A) savannah B) desert c) tundra​
Paha777 [63]

Answer:

B) desert

Explanation:

good luck have a nice day

7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the composition of the most abundant mineral compounds on earth?
    8·2 answers
  • During DNA replication what would be complementary strand to the original DNA segment GCTAAT
    8·2 answers
  • Chose the FALSE statement: When molecules are going WITH the
    5·1 answer
  • Whats the answer please???
    11·1 answer
  • How do organ cultures differ from cell cultures
    14·2 answers
  • Please tell me, in your own words, what you know about the ideas of natural selection
    15·1 answer
  • Which biomolecule do mitochondria break down in our body?
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Rough endoplasmic reticulum what is and function
    5·1 answer
  • What is the function of the placenta?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!