1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marta_Voda [28]
3 years ago
15

(13. Meiosis occurs to_____the number of chromosomes in sex cells (egg and sperm).

Biology
1 answer:
Nimfa-mama [501]3 years ago
3 0
Half .
I think that’s right .
You might be interested in
what are the living things and non- living things that are usually present in a typical Philippine rice field
Natali5045456 [20]
Jjrnnejejejieieiehnend
7 0
2 years ago
There are two types of cell division. The first (A) produces cell that are identical to the original cell. The second (B) produc
frosja888 [35]

Answer:

The first (A) produces cell that are identical to the original cell.

Explanation:

5 0
3 years ago
how the skin cells, neurons, muscle cells, and blood cells you have observed relate to the functions of skin, nerve, muscle, and
serious [3.7K]

every cell has work to do but different cells may have different jobs in multicellular organisms, cell with the same type of job often work together. These group of specialized cell from tissue in turn, tissue often group together to form larger units called organs the heart is an organ; so is the stomach.

4 0
2 years ago
What two pigments together create the color in golden-brown algae?
Svetllana [295]
ANSWER: C). Chlorophyll and carotenoids
6 0
3 years ago
Read 2 more answers
How do the various part of the body work together when we eat something
gulaghasi [49]

Answer:

Your digestive system absorbs water and nutrients from the food you eat. Your circulatory system carries oxygen, water, and nutrients to cells throughout your body. Wastes from the cells are eliminated by your respiratory system, your excretory system, and your skin.

Explanation:

6 0
3 years ago
Other questions:
  • Which of the following processes occur in melosis but do not occur in mitosis?
    15·1 answer
  • How does the body maintain homeostasis when its inner temperature becomes higher than the normal body temperature?
    12·2 answers
  • How are the roles of pecan trees and fox squirrels related within an ecosystem?
    8·1 answer
  • Why is the carbon cycle important?
    11·2 answers
  • Ming’s mother served him fried eggs for breakfast. After seeing the eggs, he noticed that they closely resembled a stage in cell
    8·2 answers
  • What type of molecules pass directly through the membrane? (Passive transport)
    14·1 answer
  • In the presence of sunlight, Vitamin D precursors are produced. This is important for the transport of sodium in our intestines.
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • homogeneity and isotropy, taken as assumptions regarding the structure and evolution of the universe, are known as
    12·1 answer
  • During the loading of tbp, what event displaces the binding of tafs 11 and 13 from one of the stirrups of tbp?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!