1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zmey [24]
3 years ago
11

Which of the following does eccentricity describe

Biology
1 answer:
shepuryov [24]3 years ago
4 0
What is the rest of the question
You might be interested in
The sequence of _____ in a dna molecule determines the protein that will be produced
Sergio039 [100]

Answer:

gene

Explanation:

8 0
3 years ago
Read 2 more answers
Which types of tissue helps to keep both out blood pressure regulated and our digestive system effective
Tomtit [17]
I’m pretty sure it is Muscle tissue
5 0
3 years ago
Every atom of the blank carbon has 6 protons
Margarita [4]
Hi There! :)

<span>Every atom of the blank carbon has 6 protons

</span><span>element</span>
6 0
3 years ago
Read 2 more answers
An atom of element A has 27 protons. What would the element's atomic number be?
erastova [34]

Answer:

27

Explanation:

The number of protons in atom is the atomic number. For a neutral atom that has not lost or gained any electron, it is the same as the number of electrons.

The atomic number is used in perfect ordering of the periodic table and it is the basis of the periodic law.

Protons are positively charged subatomic particles that reside in the in the nucleus of an atom with the neutrons.

4 0
3 years ago
I need help !!
Ilya [14]
It should be transport of waste but I’m not 100% sure :(
6 0
3 years ago
Other questions:
  • It has been estimated that 99% of the intestinal bacteria are A. facultative anaerobes.B. obligate aerobes.C. facultative aerobe
    9·1 answer
  • Animal A and Animal B each have 95% of their DNA in common. Animal A and Animal C each have 50% of their DNA in common. What doe
    5·2 answers
  • Name an example of another disorder that could be caused by a nutritional deficiency.
    10·1 answer
  • What is the largest bone in the body?
    11·1 answer
  • Explain how layers that form in ice are similar to tree<br> rings.
    8·2 answers
  • A sample of basalt has smaller crystals than a sample of granite. What is the most likely reason for this? The basalt
    12·1 answer
  • What is non living or not produced by living things
    5·1 answer
  • A person who is unable to resist infection by a particular pathogen is known as _______ in the chain of infection.
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • chloroplasts are proposed to have arisen after archaea cells engulfed , in endosymbiosis, allowing the engulfed cell to remain,
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!