1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
USPshnik [31]
3 years ago
9

ribose sugar is used to make nucleic acid however, it is not formed directly in photosynthesis but is formed from glucose. How d

oes glucose form ribose?
Biology
1 answer:
Ilia_Sergeevich [38]3 years ago
5 0

Answer: Ribose is synthesized from glucose and other monosaccharide molecules in living cells by a process known as pentose phosphate pathway. The pentose phosphate pathway is a series of chemical reactions taking place in the cytosol of cells.

You might be interested in
Which organism contains tissues?
prohojiy [21]

The correct answer would be A. seal as paramecium, bacterium, and amoeba are all single-celled organisms. Thus, they cannot be an organism with tissues.

3 0
3 years ago
Read 2 more answers
PLEASE HELP (40 POINTS) What role might the processes of protein synthesis play in using CRISPR to modify a defective gene in an
zzz [600]

Answer:

That looks hard, search on google.

Explanation:

8 0
3 years ago
The bacterial flagellum moves _______. Multiple Choice by rotation that is powered by ATP by rotation that is powered by the pro
babymother [125]

Answer:by rotation that is powered by the motive force

Explanation:

4 0
3 years ago
Why do cells need mitosis
nekit [7.7K]

Answer:

Mitosis duplicates cells

Explanation:

Without mitosis you would have never gotten pass the "zygote" phase. You would have stayed as a single cell. Mitosis makes you grow.

6 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • A forest is cut down to plant a field of corn. How will this affect the biodiversity of the area?
    11·1 answer
  • Select the structures and functions of the large intestine from the choices below
    9·1 answer
  • the inability of an organism to produce certain proteins can occur when an organism is lacking am enzyme needed to combine
    7·1 answer
  • In which habitat would you expect to find a panda bear?
    7·2 answers
  • The family that contains wolves and foxes is characterized by complex social structures. If dingoes are a part of the same famil
    13·1 answer
  • Which is a following is an example of a complex carbohydrate?
    10·1 answer
  • During photosynthesis, water molecules absorb energy from the sun. What do you think this energy does to the water molecule?
    10·1 answer
  • In what year was the first genetic disease mapped?
    15·2 answers
  • The moon itself doesn’t emit any _____ like the sun.
    11·1 answer
  • There are several ways to model a compound. One type of model is shown.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!