1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arisa [49]
3 years ago
13

Where can epithelial cells be found?

Biology
1 answer:
ollegr [7]3 years ago
6 0

Answer:

they line the outer surfaces of organs and blood vessels

Explanation:

You might be interested in
The main function of tRNA is to __________________________. A-transfer amino acids to the site of protein synthesis B-transfer t
meriva
The main function of tRNA is to __________________________.
 
The answer to this question is 

<span>A-transfer amino acids to the site of protein synthesis </span>
4 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What's stock exchange? anyone bor ed and down to talk?
loris [4]

Explanation:

It is a place where shares of pubic listed companies are traded. ... A stock exchange facilitates stock brokers to trade company stocks and other securities. A stock may be bought or sold only if it is listed on an exchange.

3 0
3 years ago
Read 2 more answers
Which physical properties do all-stars have? Check all that apply.
olga2289 [7]

Answer:

-Physical properties possessed by all stars:

  • They are made of gases such as hydrogen and helium.
  • They shine very brightly due to interaction of hydrogen and helium at appropriate pressure and temperature.
  • They contain iron in their cores which monitors the fusion reaction.
  • They make energy through fusion between the gases present in the stars which are hydrogen and helium.
  • They are not spherical in shape hence this physical property is false in terms physical properties of the stars.

Hope this helps. If it does, please mark me brainliest.

Explanation:

6 0
3 years ago
The number of waves passing the observer per second is:
MrRissso [65]

Answer:

frequency

Explanation:

comment if im wrong

5 0
3 years ago
Other questions:
  • In his breeding experiments, mendel first crossed true-breeding plants to produce a second generation, which were then allowed t
    11·1 answer
  • In the presence of a metabolic poison that specifically andcompletely inhibits the function of
    11·2 answers
  • True or False. The more threads a screw has the greater the holding power of the screw.
    10·2 answers
  • Which of the following is true about the Calvin cycle?
    14·1 answer
  • _____which is most likely to form a negative ion?<br><br> Plz help me
    7·1 answer
  • Chapter 11.1 &amp; 11.2 Notes Section 11.1 1. Every living thing has a set of ? inherited from its parents. 2. After becoming a
    8·1 answer
  • BRAINLIESTTTT ASAP!!<br><br> What are the starting compounds in the process of cellular respiration?
    10·1 answer
  • In carrying out normal activities, cells use oxygen and produce carbon dioxide. The concentration of oxygen is higher in the blo
    13·1 answer
  • Why is the find of the Chilesaurus important in understanding the evolutionary lineage of theropods?
    14·1 answer
  • Herceptin,a drug developed by the biotechnology industry, is used to treat breast cancer. it is taken only after a patient under
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!