1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laiz [17]
3 years ago
10

Pelvic bones in whales are an example of structures.​

Biology
1 answer:
lana [24]3 years ago
3 0

Answer:

The pelvic bones of whales are “one of the classic examples of a vestigial structure

Explanation:

took the test:)

You might be interested in
You are given the task of designing an aquatic protist that is a primary producer. It cannot swim on its own, yet must stay in w
luda_lava [24]
<h2>Diatoms</h2>

Explanation:

  • Diatoms are one of the most important and abundant components of marine phytoplankton with two valves (frustules) composed mainly of silica (SiO2). Average size is 10-100µm
  • Inhabit all aquatic environments. They occur in the body of the water as plankton or on the bottom where they may be attached to plants or rocks or sand particles or maybe free-living and able to move between particles of the substratum. In the open ocean, they live only in the upper 200 m of the surface water.  
  • Diatoms produce an estimated 20% to 25% photosynthesis on the planet .
  • Hence, diatoms are correct answer this is because the primary producer it must be resistant to physical damage from wave action

6 0
4 years ago
In most cells, there are more ______ molecules inside the cell and more sodium molecules outside the cell.
Harlamova29_29 [7]

Answer:

it as more organic molecules inside

7 0
3 years ago
Read 2 more answers
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
You Still Awake? 30 Points On THE LINE!!!!
Rzqust [24]

Answer:

I m still awake till now , lol

Explanation:

<h2><em><u>PLEASE</u></em><em><u> </u></em><em><u>MARK</u></em><em><u> ME</u></em><em><u> BRAINLIEST</u></em><em><u> AND</u></em><em><u> FOLLOW</u></em><em><u> ME</u></em><em><u> LOTS</u></em><em><u> OF</u></em><em><u> LOVE</u></em><em><u> FROM</u></em><em><u> MY</u></em><em><u> HEART'AND</u></em><em><u> SOUL</u></em><em><u> DARLING</u></em><em><u> TEJASWINI</u></em><em><u> SINHA</u></em><em><u> HERE</u></em><em><u> </u></em><em><u>❤️</u></em></h2>
4 0
3 years ago
Read 2 more answers
What are the themes in biology that come up again and again?
Alexeev081 [22]
What are the themes in biology that come up again & again cellular basis of life; info & heredity; matter & energy; growth, development, & reproduction; homeostasis; evolution; structure & function; unity & diversity of life; interdependence in nature; science as a way of knowing
7 0
3 years ago
Other questions:
  • As discussed in Investigating Life 15.1, why might bioluminescence be an advantage for some species of dinoflagellates?
    8·1 answer
  • What statement is true about the functions? Structure 1 is the stamen and Structure 2 is the pistil. Structure 1 is the stem and
    13·1 answer
  • The australopithecus lineage went extinct about:
    13·1 answer
  • What is a solenoid i need helpppppp!!!!!!!!
    8·2 answers
  • Dvd Credit card Stereo speaker Computer hard drive The listed devices all use which force? A) X rays B) magnetism C) electricity
    8·2 answers
  • Continental glaciers are formed from snow and ice that create long strips of glaciers in between mountains. Please select the be
    11·2 answers
  • Genetic variations that have a reproductive advantage are carried into the next generation.
    11·2 answers
  • How does photosynthesis benefit organisms on Earth?
    5·2 answers
  • Restriction enzymes are used in making recombinant DNA. Describe the role restriction enzymes perform when constructing recombin
    7·1 answer
  • Can someone please help, I dont understand thank you.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!