1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Licemer1 [7]
3 years ago
15

Anger management-

Law
1 answer:
kondor19780726 [428]3 years ago
4 0

Answer:

1. Bob’s reacting to anger by pushing the stranger out of the way.

2. Sandy’s reacting out of anger by asking them if they couldn’t do it again, and they probably didn’t mean to run into her.

3. He’s reacting out of anger by using his feelings and thoughts.

4. Sue reacting to anger by suppressing it, which could cause problems.

5. Adrian’s reacting to anger by using his feelings and thought , then shows empathy when he understands what's going on.

6.Jade’s reacting to anger by just turning on her favorite music and relaxing which is a healthy anger management.

Explanation:

You might be interested in
In which federal court district is Indianapolis in
Vitek1552 [10]
Birch Bayh Federal Building and U.S. Courthouse (Indianapolis)
4 0
4 years ago
Do you believe that the Supreme Court should practice judicial restraint
krek1111 [17]

Answer:

Judges are said to exercise judicial restraint if they are hesitant to strike down laws that are not obviously unconstitutional.

6 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Mr Y designed a special tool for his automotive shop. He commissioned Mr X to make the special tool. After Mr X completed the pr
Burka [1]

Answer:

Philo Taylor Farnsworth (August 19, 1906 – March 11, 1971) was an American inventor and television pioneer.[2][3] He made many crucial contributions to the early development of all-electronic television.[4] He is best known for his 1927 invention of the first fully functional all-electronic image pickup device (video camera tube), the image dissector, as well as the first fully functional and complete all-electronic television system.[5][6] Farnsworth developed a television system complete with receiver and camera—which he produced commercially through the Farnsworth Television and Radio Corporation from 1938 to 1951, in Fort Wayne, Indiana

7 0
4 years ago
How long do you go to jail for in US for impersonating a police officer? (NOTE: I KNOW THE ANSWER, IF YOU ARE WRONG, I WILL REPO
nexus9112 [7]

Answer:

Depending on state law, impersonating a police officer may be considered either a felony or a misdemeanor. Punishments for impersonating a police officer include: Imprisonment up to five years :D

7 0
4 years ago
Read 2 more answers
Other questions:
  • Jerome joined the police force a few months back. His seniors have sent him to investigate his very first crime scene. According
    5·2 answers
  • An untruth about a person that will likely do them harm is known as: A. Periodical B. Libel C. Obituary D. Publication
    12·1 answer
  • If a law enforcement officer suspects your vehicle is not properly maintained or does not comply with Florida motor vehicle equi
    12·2 answers
  • COPIED AND PASTED
    6·1 answer
  • Give your own example of the 5th Amendment.
    15·2 answers
  • HELPPP ANSWER THISSSSS PLS ITS DUE TODAY PLS PLS PLS PLS I WILL GIVE BRAINLIESTTTT
    7·2 answers
  • How long does a bill have to be approved by both houses of Congress?
    11·2 answers
  • What are the rights of a suspect after an arrest or detention?
    8·2 answers
  • Does texas bill allows for death penalty for women who get abortions?
    7·2 answers
  • How is harvey birdman, attorney at law different from other legal shows?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!