1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tekilochka [14]
3 years ago
12

What atre three types of nerve fibers?

Biology
2 answers:
Gelneren [198K]3 years ago
7 0

Answer:

Explanation:

Nerve fibers are classed into three types – group A nerve fibers, group B nerve fibers, and group C nerve fibers. Groups A and B are myelinated, and group C are unmyelinated. These groups include both sensory fibers and motor fibers.

Ne4ueva [31]3 years ago
7 0

group A nerve fibers

group B nerve fibers

group C nerve fibers.

You might be interested in
Bronchoconstriction is treated by inhaled
Assoli18 [71]

D. Cholinergic antagonists

8 0
3 years ago
Which of the following shows all of the tripeptides that can be formed from one molecule each of lysine (Lys), threonine (Thr),
Ierofanga [76]

Answer:

LysThrHis, LysHisThr, HisLysThr, HisThrLys, ThrLysHis, ThrHisLys

Explanation:

You easily combine the options for the tripeptide if you made a chart

Also you can calculate the posibilities with the factorial function in the calculatio (x!): 3*2*1 (you can multiplicate the number of amoniacids by the followed numbers until 1) = 6

7 0
3 years ago
Read 2 more answers
Select the correct answer. <br> What is a scientific theory?
ahrayia [7]

Answer:

Scientific theory definition, a coherent group of propositions formulated to explain a group of facts or phenomena in the natural world and repeatedly confirmed through experiment or observation: the scientific theory of evolution.

Explanation:

7 0
3 years ago
What can directly lead to unconformity on an exposed rock?
Scorpion4ik [409]
The answer is B. Uneven rock layer.
Uneven rock layer can directly lead to nonconformity on an exposed rock. Usually the rocks are layered evenly. When the rocks are uneven it will be exposed and show different kind of rocks.
7 0
2 years ago
Read 2 more answers
8. Unlike DNA, RNA
Aliun [14]

Answer:

D

Explanation:

DNA pairs with adenosine, thymine, cytosine, and guanine

RNA pairs with uracil, adenosine, cytosine, and guanine

5 0
3 years ago
Other questions:
  • A scientist investigates two types of cells located in different parts in the human body. Cell A contains many more mitochondria
    7·2 answers
  • In their first attempts to genetically engineer a cow that will make and secrete human growth hormones in milk, scientists found
    14·1 answer
  • The cell membrane is the structure that encloses the cell and regulates the passage of materials between the cell and its enviro
    14·1 answer
  • What is an element?
    13·1 answer
  • The portion of the DNA molecule that can vary is its
    7·1 answer
  • Which of the following statements is not true?
    9·1 answer
  • What are you he advantages to the body in the change in breathing and heart rates ?
    14·2 answers
  • Why must you include the water soluble vitamins in your daily diet?
    14·1 answer
  • What are examples of a medium
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!