1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlada-n [284]
3 years ago
10

10 pointsSIENCE

Biology
1 answer:
lawyer [7]3 years ago
4 0

Answer:

<h2>c. glucose</h2>

Explanation:

it is broken down to produce energy

You might be interested in
Chromosomes are formed during which stage of<br> mitosis?
Black_prince [1.1K]

Answer: Prophase

Explanation: Prophase, is the first and longest phase of mitosis. First, chromtain condense it into chromosomes and the nuclear membrane breaks it down.

                   

6 0
3 years ago
_____________ can change based on the force of gravity on an object.
liberstina [14]

Answer:

A mass

Explanation:

I learned it in 8th grade.

6 0
3 years ago
Read 2 more answers
The producers at the beginning of Earth's food chain are _____
Arturiano [62]
The producers at the beginning of the Earth's food chain are plants.
6 0
3 years ago
PLEASE HELP!!! ASAP
mylen [45]
The one with the the limestone thingy is faster  because the friction is loss  
my educational guess

6 0
3 years ago
Read 2 more answers
Sperm cells get energy to power their movement from __________, which is contributed by the __________.
777dan777 [17]
Fructose; seminal vesicles


3 0
3 years ago
Other questions:
  • Which of the following is not required for osmosis to occur?
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Differentiate between light and electron microscopy.
    7·1 answer
  • Xylem and _______________ are the two types of tissue that comprise a plant's vascular tissue.
    14·1 answer
  • The environmental cue that determines the night of gamete release during a particular month is:
    12·1 answer
  • Que diferencia hay entre un metiorito y un asteroide?​
    13·1 answer
  • Respiration is a process where many chemical bonds inside the body break and release energy. This energy is used to perform vari
    10·1 answer
  • What is the difference between a trait and a variation
    15·1 answer
  • What 2 plants in Yellowstone national park declined as a result of the elk population boom?
    14·1 answer
  • Which of the following is a slow moving nutrient<br> A. oxygen<br> B. phosphorus<br> C. hydrogen
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!