1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaK [193]
3 years ago
13

3/2-x + 5/4-2x - 1/x-2 =4

Mathematics
1 answer:
dimaraw [331]3 years ago
3 0
Is there like a question???
You might be interested in
3 2/5 time 5. Show work
xenn [34]

let's firstly convert the mixed fraction to improper fraction and then multiply.

\bf \stackrel{mixed}{3\frac{2}{5}}\implies \cfrac{3\cdot 5+2}{5}\implies \stackrel{improper}{\cfrac{17}{5}} \\\\[-0.35em] ~\dotfill\\\\ \cfrac{17}{~~\begin{matrix} 5 \\[-0.7em]\cline{1-1}\\[-5pt]\end{matrix}~~}\cdot ~~\begin{matrix} 5 \\[-0.7em]\cline{1-1}\\[-5pt]\end{matrix}~~\implies 17

8 0
3 years ago
The point P(6, –1) is translated according to the rule (x, y) → (x – 5, y – 2).
monitta

The <em>resulting</em> point by considering that P(x, y) = (6, - 1) and P'(x, y) = P(x, y) + (- 5, - 2) is equal to the coordinates P'(x, y) = (1, - 3). (Right choice: C)

<h3>How to determined a resulting point by translation</h3>

In this question we need to determine the new location of a point by using a <em>translation</em> formula. Translations are rigid transformations in which a point is translated on a <em>Cartesian</em> plane. We have the following formula:

P'(x, y) = P(x, y) + (- 5, - 2)     (1)

Where:

  • P(x, y) - Original point
  • P'(x, y) - Resulting point

If we know that P(x, y) = (6, - 1), then the resulting point is:

P'(x, y) = (6, - 1) + (- 5, - 2)

P'(x, y) = (1, - 3)

The <em>resulting</em> point by considering that P(x, y) = (6, - 1) and P'(x, y) = P(x, y) + (- 5, - 2) is equal to the coordinates P'(x, y) = (1, - 3). (Right choice: C)

To learn more on translations: brainly.com/question/17152175

#SPJ1

6 0
2 years ago
How to write this in slope-intercept form? 8x + 10y = 40
worty [1.4K]

Answer:y=-4/5x+4

Step-by-step explanation:

4 0
3 years ago
Read 2 more answers
10. You used 8 cups of sugar while baking three dozen cookies and one cake. If you used 1.25 cups of sugar for the cake and the
DanielleElmas [232]

Answer:

I got 5.65

Step-by-step explanation:

36/8= 4.5,  4.5 +1.25= 5.65

8 0
3 years ago
Which awnser is an equation in point-slope form for the given point and slope?
ExtremeBDS [4]

The correct answer is B) y + 9 = 2(x - 1)

In order to find this, simply take the point and the slope and plug into the base form of point-slope form.

y - y1 = m(x - x1)

Use the slope for m and the point for (x1, y1)

y + 9 = 2(x - 1)

3 0
3 years ago
Other questions:
  • Use addition or substitution to find the value of y for this set of equations. 4x + 13y = 40 4x + 3y = -40
    5·1 answer
  • In geometry how you get surface number on a shape with three different measurements
    10·1 answer
  • If a=2 and b=3 then what does ab^2 equal
    8·2 answers
  • Five times the sum of a number and 13 is 20. Find the number
    8·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 1000^m/100^n can be written in the form 10z express z in terms of m and n
    13·1 answer
  • Help pls ............
    9·1 answer
  • Which ordered pair is the solution to the system of linear equations y=-7X+2 and y = 9%-14?
    11·1 answer
  • I need help with my homework question 3​
    9·1 answer
  • Identify quadratic patte
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!