It is called haemogloblin.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Because they have so many children at once.
Following are the best conditions or examples for the natural selection to occur:
• More organisms are born than can survive.
• Organisms vary in their characteristics, even within a species.
• Differences in reproduction and survival are due to variation among organisms.
Hope so, this answer will help you.
There are 42 chromosomes in the body.