1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mademuasel [1]
3 years ago
13

Why is it critical that equal amounts of DNA are shared between homologous chromosomes?

Biology
1 answer:
harina [27]3 years ago
6 0
<span>Homologous chromosomes are chromosomes of equal length, size, and of corresponding genetic material. If, during meiosis, these chromosomes divide improperly, when they are re-combined with the opposite sex's portion, they will combine improperly. The unequal distribution of genetic material in reproduction will eventually create what's call an aneuploid germ cell: this germ cell results in dead zygotes, which leads to a miscarriage or spontaneous abortion in about 25 percent of all conceptions. So we see that it is imperative the genetic material of these chromosomes be exactly where it is supposed to be: so that it can combine perfectly with its compliment.</span>
You might be interested in
Iron containing molecule in red blood cells is called
Rainbow [258]
It is called haemogloblin.
6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Why are spiders considered to be an r selected species?
Alona [7]

Because they have so many children at once.

7 0
3 years ago
What example best illustrates a condition for natural selection to occur
grandymaker [24]

Following are the best conditions or examples for the natural selection to occur:

• More organisms are born than can survive.

• Organisms vary in their characteristics, even within a species.  

• Differences in reproduction and survival are due to variation among organisms.

Hope so, this answer will help you.

3 0
3 years ago
What is a short sentence including the word chromosome
Vilka [71]
There are 42 chromosomes in the body.
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is meant by desert?
    7·2 answers
  • For the body to function normally, the organs and tissues must communicate to control the development of the cells and tissues.
    12·1 answer
  • Where does mechanical breakdown of food occurs?
    11·1 answer
  • The afrikaner population of dutch settlers in south africa is descended mainly from a few colonists. today, the afrikaner popula
    5·2 answers
  • Why do living organisms release energy gradually?
    14·1 answer
  • Which of these phases encompasses all of the stages of mitosis? A pie chart of the cell cycle that consists of two parts. The bi
    14·2 answers
  • Marine biology
    14·2 answers
  • What is a lipid that makes up cell membranes and is used to create hormones?
    11·1 answer
  • Need help asap!!!!!!!!!
    12·1 answer
  • DNA contains coded information for _____.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!