There are three possible types of room in the hospital:
1. ward (3-4 patients)
2. semi-private room (2 patients)
3. private room (1 patient).
Incidence of hospital-acquired infections is growing, so it would be desirable to promote greater safety for patients in order to avoid those nosocomial infections. So, the best way to prevent the spread of infections is to put patients that are contagious into semi-private and private rooms.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Mixtures can be separated using a variety of techniques. Chromatography involves solvent separation on a solid medium. ... Evaporation removes a liquid from a solution to leave a solid material. Filtration separates solids of different sizes.
Surface water changes into a gas and enters the atmosphere.