1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
3 years ago
8

How much energy transfers from one level to the next?

Biology
1 answer:
daser333 [38]3 years ago
4 0
10% energy transfers form one level to next
You might be interested in
What is the chance that the offspring will have hair?
11Alexandr11 [23.1K]

Answer:

2 in 4, 50 percent

Explanation:

in the punnet square, you can see that half the boxes ar Hh, which means the offspring will have hair.

6 0
3 years ago
Need an answer to #7<br> WILL MARK BRAINLIEST IF CORRECT
Sever21 [200]

Answer i think that B

Explanation:

6 0
4 years ago
Read 2 more answers
In certain cancers, the GTPase activity of the RAS G-protein is inhibited. This means that the RAS protein can no longer hydroly
Valentin [98]
<h2>Flagging pathway EGFR development       </h2>

Explanation:

  • The epidermal development factor (EGF) receptor (EGFR) is a receptor tyrosine kinase associated with the guideline of cell development, wound mending, and tissue fix. When EGF ties to the EGFR, a course of downstream occasions makes the cell develop and isolate. In the event that EGFR is actuated at improper occasions, uncontrolled cell development (malignancy) may happen.
  • After the ligand ties to the phone surface receptor, the initiation of the receptor's intracellular parts sets off a chain of occasions that is known as a flagging pathway, here and there called a flagging course. In a flagging pathway, second delivery people catalysts and enacted proteins interface with explicit proteins, which are thus initiated in a chain response that in the long run prompts an adjustment in the cell's condition  
  • For example, an expansion in digestion or explicit quality articulation. The occasions in the course happen in an arrangement, much like an ebb and flow streams in a waterway. Collaborations that happen before a specific point are characterized as upstream occasions, and occasions after that point are called downstream occasions.

7 0
3 years ago
Using information found on the Internet, describe the features of Therapsids that suggest this group was transitional to reptile
denis23 [38]
Therapsids are a group of mammal like reptiles that share many features of the body. So basically what this means is that these animals from the Therapsids helps the humans evolve. Therapsids had canine teeth and so do mammals. Their jaws where structured similar to ours and so were their teeth. Their molars were in the back so they chomp their food like meat, just like the humans. The reptiles in the Therapsids group have legs that were more vertical from their body like humans. Where other reptiles did not, they had legs that were sprawled out from their body.The reptiles in the Therapsids group also had turbinates bones like humans. They were also thought to be warm blooded just like humans. There are some similarities that could leave one to believe that there is a connection, but I don’t think so. I think that humans have a more thing in <span>common with chimpanzees</span>
8 0
3 years ago
Read 2 more answers
I need help with this question
suter [353]

Answer:

more complex cell

Explanation:

hope this will help

4 0
3 years ago
Other questions:
  • Because dna has a _______ charge, it moves to the _______ end of the field in gel electrophoresis. the _______ dna molecules mig
    14·1 answer
  • Which best describes the final phase in our sun's life cycle?
    5·2 answers
  • Treatment of an animal bite for possible rabies includes a. debridement. b. washing bite with soap or detergent. c. postexposure
    12·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • How has the study of mitosis affected scientists’ knowledge of cancer?
    6·1 answer
  • About one in every ____ people infected with hiv is not aware of the infection.
    5·1 answer
  • The signals for mucus release include
    7·1 answer
  • Fill in the blank: The variable that is changed by the scientist in an experiment is the
    5·1 answer
  • I need a writing prompt make it opinion and school appropriate. 7-11 gradw
    10·2 answers
  • During the process of polymerization, ______
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!