Answer:
embryos (the organisms early stage foetal development )
<span>A drug used to treat CML, imatinib, binds to the active site of Abl kinase. Why does this drug work to treat this type of cancer?
</span><span>B) By binding to the active site, the drug prevents the ability of Abl kinase to bind to its substrate.
</span>
Imatinib works against CML by binding close to the ATP binding site of bcr-abl. The binding results to the<span> locking in of the bcr-abl to a closed or self-inhibited conformation and inhibiting the enzyme activity of the protein </span><span>semi-competitively.</span>
Answer:
Anticodon. The anticodon region of a transfer RNA is a sequence of three bases that are complementary to a codon in the messenger RNA. During translation , the bases of the anticodon form complementary base pairs witht the bases of the codon by forming the appropriate hydrogen bonds.
move in a circle on a central axis.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand