1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
2 years ago
6

Arrange the steps of the chemical response of a cell to epinephrine in the correct order. 1. production of GTP from GDP 2. conve

rsion of cyclic AMP to ATP 3. activation of a G protein in the cell membrane 4. release of glucose into the bloodstream 5. activation of adenylate cyclase 6. conversion of ATP to cyclic AMP
Biology
1 answer:
evablogger [386]2 years ago
8 0

Answer:

3, 1, 5, 6, 4, 2.

Explanation:

Epinephrine (i.e., adrenaline) is a hormone secreted by the adrenal glands and some neurons. This hormone binds to a type of G protein-coupled receptor called beta-adrenergic receptors. This binding results in the activation of adenylate cyclase and the intracellular production of a second messenger known as cyclic adenosine monophosphate (cAMP), which is synthesized from adenosine triphosphate (ATP). cAMP activates different kinases that phosphorylate specific protein substrates, thereby activating and inhibiting different enzymatic reactions. Finally, this process activates an enzyme called glycogen phosphorylase that breaks down glycogen into glucose which is released in the blood.

You might be interested in
To determine the evolutionary relationships among organisms scientist compare what
VMariaS [17]
Answer:
embryos (the organisms early stage foetal development )
5 0
3 years ago
Read 2 more answers
Chronic Myelogenous Leukemia (CML) is a type of cancer that is caused by a specific chromosomal alteration that leads to the ina
Degger [83]
<span>A drug used to treat CML, imatinib, binds to the active site of Abl kinase. Why does this drug work to treat this type of cancer?

</span><span>B) By binding to the active site, the drug prevents the ability of Abl kinase to bind to its substrate.
</span>
Imatinib works against CML by binding close to the ATP binding site of bcr-abl. The binding results to the<span> locking in of the bcr-abl to a closed or self-inhibited conformation and inhibiting the enzyme activity of the protein </span><span>semi-competitively.</span>
4 0
3 years ago
Which of the following occurs after a condon and anticondon form hydrogen bonds<br><br>​
xxTIMURxx [149]

Answer:

Anticodon. The anticodon region of a transfer RNA is a sequence of three bases that are complementary to a codon in the messenger RNA. During translation , the bases of the anticodon form complementary base pairs witht the bases of the codon by forming the appropriate hydrogen bonds.

8 0
3 years ago
To revolve means to __________.
Yuki888 [10]

move in a circle on a central axis.

4 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • Using the gas pedal analogy explain the impact on the cell cycle of a proto
    5·1 answer
  • How are lysomes and vaculoes the same?How are they different?
    10·1 answer
  • Darwin had very few fossils to support his theory of evolution by means of natural selection when he published On the Origin of
    6·1 answer
  • Most freshwater Hydrozoa exist only as ______.
    12·1 answer
  • Which of the following is an inference?
    10·2 answers
  • How does location best represents the relationship between structure and function?
    10·1 answer
  • Judy kept 250 grams of juice in the freezer. What is most likely the mass of the frozen juice formed and why?
    15·2 answers
  • JBJBJBJBJBJBJBJBJKBJKBJB
    6·2 answers
  • VERY EASY QUESTION. WILL MARK BRAINLIEST When is the peak hurricane season for the Atlantic Ocean Basin, and why do hurricanes p
    10·1 answer
  • A process that increases genetic diversity during meiosis
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!