1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brums [2.3K]
3 years ago
15

What have been the four hottest years on record, globally? And how much have global average temperatures climbed since 1850?

Biology
1 answer:
Drupady [299]3 years ago
5 0
The year 2016, with a temperature deviation of 0.94°C, is considered to be the hottest year on record. 2015 and 2017 came close in second and third respectively with temperature deviations of 0.9°C and 0.84°C respectively. 2014’s temperature deviation of 0.74°C made a constant rise in global temperatures from 2014 to 2016. Only 2017 recorded the initial fall in temperatures which had been experienced continuously from 2014, spanning through 2015 and 2016. Hope this helped.
You might be interested in
Different forms of the same gene are referred to as:
Masteriza [31]

Answer:

Alleles

Explanation:

In diploid organism, genes occur in pairs on chromosomes and such pairs are referred to as allelic pairs. An allele is an alternative form of the same gene that controls the development of a pair of contrasting genes. The genetic constitution of an organism is known as genotype while its phenotype refers to a set of observable characteristics of an organism which are an expression of an individual genotype.

6 0
3 years ago
Read 2 more answers
What is a phenotype?
Papessa [141]

Answer:

a. the result of an individual's genetic constitution

Explanation:

Phenotype is the morphological expression of genotype. The genetic constituent of an individual is known as genotype. Genotype determines the genetic traits and imparts specific features of the organisms which constitute the phenotype of the organism.

The phenotype of the organisms depends on the type of the alleles of the genes present in the genome of the organisms.

For example, a human with genotype "ii" has blood type "O". Here, "ii" is the genotype that is responsible for phenotype "O blood type".

On the other hand, a human with genotype "IAIA" has blood type "A". Here. "blood type A" is the phenotype.

3 0
2 years ago
Suppose you have identified a type of lizard that seems to have acquired a mutation in which hindlimbs are absent. Which gene, a
slavikrds [6]

Answer:

Sonic Hedgehog.

Explanation:

Sonic hedgehog is a secreted protein that in humans is encoded by the SHH gene. It is the best studied ligand of the hedgehog signaling pathway, others being desert hedgehog (DHH) and Indian hedgehog (IHH). It plays a key role in the development of animals, from insects to mammals. In vertebrates, it is involved in organogenesis, including the growth of digits on limbs and the organization of the brain.

Sonic hedgehog has also been shown to act as an axonal guidance cue. It has been demonstrated that SHH attracts commissural axons at the ventral midline of the developing spinal cord. Specifically, SHH attracts retinal ganglion cell (RGC) axons at low concentrations and repels them at higher concentrations

7 0
3 years ago
Someone please help me I promise to mark brainlest!!
Ilya [14]

Answer:

The organisms homeostasis

3 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Other questions:
  • Large proteins such as albumin remain in capillaries rather than diffusing out, resulting in the:______.
    5·1 answer
  • As natural selection influences a population, the population becomes
    9·2 answers
  • 36 POINTS. _______is the involuntary movement of the muscles that move food through the digestive system. PLEASE ANSWER RIGHT NO
    10·2 answers
  • Which process of alimentary canal that remove undigested food from body? *
    7·1 answer
  • What do you mean by environmental degardation?​
    6·2 answers
  • What is the map distance between c and sh
    9·1 answer
  • If a truck has a mass of 4,250Kg and has a velocity of 20m/s, and a car has a mass of 2,350Kg and a velocity of 24m/s, what is t
    11·1 answer
  • Crossing-over occurs in prophase of mitosis and meiosis.<br> True<br> False
    9·1 answer
  • Physiology Of Digestion Of Earthworm In Simple Word Of Mouth​
    14·1 answer
  • Reading Focus Question:<br> Which parts of the biodome<br> contain carbon?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!