1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nina [5.8K]
3 years ago
8

The kidneys are organs of the body that work to maintain homeostasis. Which of the following is most likely to occur if a person

’s kidneys suddenly stop functioning?
(A) a decrease in blood volume

(B) an increase in urine production

(C) a decrease in mass of the stomach

(D) an increase in toxin levels in the blood
Biology
2 answers:
Yuri [45]3 years ago
5 0
The answer is B an increase in urine production
Elena L [17]3 years ago
4 0

Answer:

An increase in urine production

Explanation:

It is because when kidney suddenly stops body fills with extra water and waste product which suddenly increase the level of urine.

You might be interested in
Please help.What would you expect to occur if you were to repeatedly lift 25 pounds over your head for 1 minute,
nordsb [41]

Answer:

Strengthen the arms.

Explanation:

If a person repeatedly lift 25 pounds of weight over the head for 1 minute and then rest for 1 minute, the outcome of this exercise is to strengthen the muscles of the arms. The lifting of weight with the help of arms, the muscles of the arms will get stronger and increase occurs in the width of the arms. This exercise done by bodybuilders to get their arms stronger as well as athlete for stronger arms and hand muscles so the outcome of lifting the weight will leads to the increase in the strength of the arms.

3 0
3 years ago
This type of mutation is called a __________ mutation when there is a simple change in one base of the gene sequence.
ICE Princess25 [194]

Answer:

it may be point or silent mutation,they're both kinda the same thing.

7 0
3 years ago
Which body system would be directely affected is T cells were destroyed by a virus like HIV?
marissa [1.9K]
The body system that would be directly affedted is the immune system
3 0
3 years ago
A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
padilas [110]

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

4 0
3 years ago
Seattle is a “rainy place.” this statement refers to
den301095 [7]
Is this multiple choice or no?
8 0
4 years ago
Read 2 more answers
Other questions:
  • Which nutrient cycle is most affected by the over-use of ammonia fertilizers on commercial farms, as well as by the accumulation
    9·2 answers
  • Which of these correctly describes how organic catalysts operate in biological reactions?
    6·1 answer
  • What would happen if a cell didn’t have a cytoskeleton
    15·1 answer
  • Many different types of mutations can occur within the body. Cystic fibrosis is a genetic disorder that is caused by different m
    7·1 answer
  • Why do daughter cells have DNA that is identical to the parent cell? Explain your answer.
    15·1 answer
  • Which statement is scientifically based
    8·2 answers
  • Which statement is true of a chemical reaction Energy is always released energy is always absorbed energy is not transferred ene
    10·1 answer
  • Which of these statements is true about the gene pool and genetic diversity?
    14·1 answer
  • What do mitochondria and chloroplasts have in common
    7·1 answer
  • GlaxoSmithKline would become more ________ if it starts allowing its lab scientists to set the priorities and allocate the resou
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!